Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

mIR-100...mIR-199

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0122 hsa-miR-100-3p Mimic CAAGCUUGUAUCUAUAGGUAUG 5 nmol ¥38,000
INH0122 hsa-miR-100-3p Inhibitor CAAGCUUGUAUCUAUAGGUAUG 5 nmol ¥38,000
MIM0121 hsa-miR-100-5p Mimic AACCCGUAGAUCCGAACUUGUG 5 nmol ¥38,000
INH0121 hsa-miR-100-5p Inhibitor AACCCGUAGAUCCGAACUUGUG 5 nmol ¥38,000
MIM0124 hsa-miR-101-3p Mimic UACAGUACUGUGAUAACUGAA 5 nmol ¥38,000
INH0124 hsa-miR-101-3p Inhibitor UACAGUACUGUGAUAACUGAA 5 nmol ¥38,000
MIM0123 hsa-miR-101-5p Mimic CAGUUAUCACAGUGCUGAUGCU 5 nmol ¥38,000
INH0123 hsa-miR-101-5p Inhibitor CAGUUAUCACAGUGCUGAUGCU 5 nmol ¥38,000
MIM0128 hsa-miR-105-3p Mimic ACGGAUGUUUGAGCAUGUGCUA 5 nmol ¥38,000
INH0128 hsa-miR-105-3p Inhibitor ACGGAUGUUUGAGCAUGUGCUA 5 nmol ¥38,000
MIM0129 hsa-miR-105-5p Mimic UCAAAUGCUCAGACUCCUGUGGU 5 nmol ¥38,000
INH0129 hsa-miR-105-5p Inhibitor UCAAAUGCUCAGACUCCUGUGGU 5 nmol ¥38,000
MIM0132 hsa-miR-106a-3p Mimic CUGCAAUGUAAGCACUUCUUAC 5 nmol ¥38,000
INH0132 hsa-miR-106a-3p Inhibitor CUGCAAUGUAAGCACUUCUUAC 5 nmol ¥38,000
MIM0130 hsa-miR-106a-5p Mimic AAAAGUGCUUACAGUGCAGGUAG 5 nmol ¥38,000
INH0130 hsa-miR-106a-5p Inhibitor AAAAGUGCUUACAGUGCAGGUAG 5 nmol ¥38,000
MIM0131 hsa-miR-106b-3p Mimic CCGCACUGUGGGUACUUGCUGC 5 nmol ¥38,000
INH0131 hsa-miR-106b-3p Inhibitor CCGCACUGUGGGUACUUGCUGC 5 nmol ¥38,000
MIM0133 hsa-miR-106b-5p Mimic UAAAGUGCUGACAGUGCAGAU 5 nmol ¥38,000
INH0133 hsa-miR-106b-5p Inhibitor UAAAGUGCUGACAGUGCAGAU 5 nmol ¥38,000
MIM0134 hsa-miR-107 Mimic AGCAGCAUUGUACAGGGCUAUCA 5 nmol ¥38,000
INH0134 hsa-miR-107 Inhibitor AGCAGCAUUGUACAGGGCUAUCA 5 nmol ¥38,000
MIM0135 hsa-miR-122-3p Mimic AACGCCAUUAUCACACUAAAUA 5 nmol ¥38,000
INH0135 hsa-miR-122-3p Inhibitor AACGCCAUUAUCACACUAAAUA 5 nmol ¥38,000
MIM0136 hsa-miR-122-5p Mimic UGGAGUGUGACAAUGGUGUUUG 5 nmol ¥38,000
INH0136 hsa-miR-122-5p Inhibitor UGGAGUGUGACAAUGGUGUUUG 5 nmol ¥38,000
MIM0138 hsa-miR-124-3p Mimic UAAGGCACGCGGUGAAUGCC 5 nmol ¥38,000
INH0138 hsa-miR-124-3p Inhibitor UAAGGCACGCGGUGAAUGCC 5 nmol ¥38,000
MIM0137 hsa-miR-124-5p Mimic CGUGUUCACAGCGGACCUUGAU 5 nmol ¥38,000
INH0137 hsa-miR-124-5p Inhibitor CGUGUUCACAGCGGACCUUGAU 5 nmol ¥38,000
MIM0139 hsa-miR-125a-3p Mimic ACAGGUGAGGUUCUUGGGAGCC 5 nmol ¥38,000
INH0139 hsa-miR-125a-3p Inhibitor ACAGGUGAGGUUCUUGGGAGCC 5 nmol ¥38,000
MIM0143 hsa-miR-125a-5p Mimic UCCCUGAGACCCUUUAACCUGUGA 5 nmol ¥38,000
INH0143 hsa-miR-125a-5p Inhibitor UCCCUGAGACCCUUUAACCUGUGA 5 nmol ¥38,000
MIM0140 hsa-miR-125b-1-3p Mimic ACGGGUUAGGCUCUUGGGAGCU 5 nmol ¥38,000
INH0140 hsa-miR-125b-1-3p Inhibitor ACGGGUUAGGCUCUUGGGAGCU 5 nmol ¥38,000
MIM0141 hsa-miR-125b-2-3p Mimic UCACAAGUCAGGCUCUUGGGAC 5 nmol ¥38,000
INH0141 hsa-miR-125b-2-3p Inhibitor UCACAAGUCAGGCUCUUGGGAC 5 nmol ¥38,000
MIM0142 hsa-miR-125b-5p Mimic UCCCUGAGACCCUAACUUGUGA 5 nmol ¥38,000
INH0142 hsa-miR-125b-5p Inhibitor UCCCUGAGACCCUAACUUGUGA 5 nmol ¥38,000
MIM0145 hsa-miR-126-3p Mimic UCGUACCGUGAGUAAUAAUGCG 5 nmol ¥38,000
INH0145 hsa-miR-126-3p Inhibitor UCGUACCGUGAGUAAUAAUGCG 5 nmol ¥38,000
MIM0144 hsa-miR-126-5p Mimic CAUUAUUACUUUUGGUACGCG 5 nmol ¥38,000
INH0144 hsa-miR-126-5p Inhibitor CAUUAUUACUUUUGGUACGCG 5 nmol ¥38,000
MIM0147 hsa-miR-127-3p Mimic UCGGAUCCGUCUGAGCUUGGCU 5 nmol ¥38,000
INH0147 hsa-miR-127-3p Inhibitor UCGGAUCCGUCUGAGCUUGGCU 5 nmol ¥38,000
MIM0146 hsa-miR-127-5p Mimic CUGAAGCUCAGAGGGCUCUGAU 5 nmol ¥38,000
INH0146 hsa-miR-127-5p Inhibitor CUGAAGCUCAGAGGGCUCUGAU 5 nmol ¥38,000
MIM0148 hsa-miR-128 Mimic UCACAGUGAACCGGUCUCUUU 5 nmol ¥38,000
INH0148 hsa-miR-128 Inhibitor UCACAGUGAACCGGUCUCUUU 5 nmol ¥38,000
MIM0150 hsa-miR-129-1-3p Mimic AAGCCCUUACCCCAAAAAGUAU 5 nmol ¥38,000
INH0150 hsa-miR-129-1-3p Inhibitor AAGCCCUUACCCCAAAAAGUAU 5 nmol ¥38,000
MIM0149 hsa-miR-129-2-3p Mimic AAGCCCUUACCCCAAAAAGCAU 5 nmol ¥38,000
INH0149 hsa-miR-129-2-3p Inhibitor AAGCCCUUACCCCAAAAAGCAU 5 nmol ¥38,000
MIM0151 hsa-miR-129-5p Mimic CUUUUUGCGGUCUGGGCUUGC 5 nmol ¥38,000
INH0151 hsa-miR-129-5p Inhibitor CUUUUUGCGGUCUGGGCUUGC 5 nmol ¥38,000
MIM0154 hsa-miR-130a-3p Mimic CAGUGCAAUGUUAAAAGGGCAU 5 nmol ¥38,000
INH0154 hsa-miR-130a-3p Inhibitor CAGUGCAAUGUUAAAAGGGCAU 5 nmol ¥38,000
MIM0155 hsa-miR-130a-5p Mimic UUCACAUUGUGCUACUGUCUGC 5 nmol ¥38,000
INH0155 hsa-miR-130a-5p Inhibitor UUCACAUUGUGCUACUGUCUGC 5 nmol ¥38,000
MIM0153 hsa-miR-130b-3p Mimic CAGUGCAAUGAUGAAAGGGCAU 5 nmol ¥38,000
INH0153 hsa-miR-130b-3p Inhibitor CAGUGCAAUGAUGAAAGGGCAU 5 nmol ¥38,000
MIM0152 hsa-miR-130b-5p Mimic ACUCUUUCCCUGUUGCACUAC 5 nmol ¥38,000
INH0152 hsa-miR-130b-5p Inhibitor ACUCUUUCCCUGUUGCACUAC 5 nmol ¥38,000
MIM0157 hsa-miR-132-3p Mimic UAACAGUCUACAGCCAUGGUCG 5 nmol ¥38,000
INH0157 hsa-miR-132-3p Inhibitor UAACAGUCUACAGCCAUGGUCG 5 nmol ¥38,000
MIM0156 hsa-miR-132-5p Mimic ACCGUGGCUUUCGAUUGUUACU 5 nmol ¥38,000
INH0156 hsa-miR-132-5p Inhibitor ACCGUGGCUUUCGAUUGUUACU 5 nmol ¥38,000
MIM0863 hsa-miR-133a-3p Mimic UUUGGUCCCCUUCAACCAGCUG 5 nmol ¥38,000
INH0863 hsa-miR-133a-3p Inhibitor UUUGGUCCCCUUCAACCAGCUG 5 nmol ¥38,000
MIM0864 hsa-miR-133a-5p Mimic AGCUGGUAAAAUGGAACCAAAU 5 nmol ¥38,000
INH0864 hsa-miR-133a-5p Inhibitor AGCUGGUAAAAUGGAACCAAAU 5 nmol ¥38,000
MIM0158 hsa-miR-134 Mimic UGUGACUGGUUGACCAGAGGGG 5 nmol ¥38,000
INH0158 hsa-miR-134 Inhibitor UGUGACUGGUUGACCAGAGGGG 5 nmol ¥38,000
MIM0160 hsa-miR-135a-3p Mimic UAUAGGGAUUGGAGCCGUGGCG 5 nmol ¥38,000
INH0160 hsa-miR-135a-3p Inhibitor UAUAGGGAUUGGAGCCGUGGCG 5 nmol ¥38,000
MIM0162 hsa-miR-135a-5p Mimic UAUGGCUUUUUAUUCCUAUGUGA 5 nmol ¥38,000
INH0162 hsa-miR-135a-5p Inhibitor UAUGGCUUUUUAUUCCUAUGUGA 5 nmol ¥38,000
MIM0159 hsa-miR-135b-3p Mimic AUGUAGGGCUAAAAGCCAUGGG 5 nmol ¥38,000
INH0159 hsa-miR-135b-3p Inhibitor AUGUAGGGCUAAAAGCCAUGGG 5 nmol ¥38,000
MIM0161 hsa-miR-135b-5p Mimic UAUGGCUUUUCAUUCCUAUGUGA 5 nmol ¥38,000
INH0161 hsa-miR-135b-5p Inhibitor UAUGGCUUUUCAUUCCUAUGUGA 5 nmol ¥38,000
MIM0164 hsa-miR-136-3p Mimic CAUCAUCGUCUCAAAUGAGUCU 5 nmol ¥38,000
INH0164 hsa-miR-136-3p Inhibitor CAUCAUCGUCUCAAAUGAGUCU 5 nmol ¥38,000
MIM0163 hsa-miR-136-5p Mimic ACUCCAUUUGUUUUGAUGAUGGA 5 nmol ¥38,000
INH0163 hsa-miR-136-5p Inhibitor ACUCCAUUUGUUUUGAUGAUGGA 5 nmol ¥38,000
MIM0165 hsa-miR-137 Mimic UUAUUGCUUAAGAAUACGCGUAG 5 nmol ¥38,000
INH0165 hsa-miR-137 Inhibitor UUAUUGCUUAAGAAUACGCGUAG 5 nmol ¥38,000
MIM0167 hsa-miR-138-1-3p Mimic GCUACUUCACAACACCAGGGCC 5 nmol ¥38,000
INH0167 hsa-miR-138-1-3p Inhibitor GCUACUUCACAACACCAGGGCC 5 nmol ¥38,000
MIM0168 hsa-miR-138-2-3p Mimic GCUAUUUCACGACACCAGGGUU 5 nmol ¥38,000
INH0168 hsa-miR-138-2-3p Inhibitor GCUAUUUCACGACACCAGGGUU 5 nmol ¥38,000
MIM0166 hsa-miR-138-5p Mimic AGCUGGUGUUGUGAAUCAGGCCG 5 nmol ¥38,000
INH0166 hsa-miR-138-5p Inhibitor AGCUGGUGUUGUGAAUCAGGCCG 5 nmol ¥38,000
MIM0169 hsa-miR-139-3p Mimic GGAGACGCGGCCCUGUUGGAGU 5 nmol ¥38,000
INH0169 hsa-miR-139-3p Inhibitor GGAGACGCGGCCCUGUUGGAGU 5 nmol ¥38,000
MIM0170 hsa-miR-139-5p Mimic UCUACAGUGCACGUGUCUCCAG 5 nmol ¥38,000
INH0170 hsa-miR-139-5p Inhibitor UCUACAGUGCACGUGUCUCCAG 5 nmol ¥38,000
MIM0172 hsa-miR-140-3p Mimic UACCACAGGGUAGAACCACGG 5 nmol ¥38,000
INH0172 hsa-miR-140-3p Inhibitor UACCACAGGGUAGAACCACGG 5 nmol ¥38,000
MIM0171 hsa-miR-140-5p Mimic CAGUGGUUUUACCCUAUGGUAG 5 nmol ¥38,000
INH0171 hsa-miR-140-5p Inhibitor CAGUGGUUUUACCCUAUGGUAG 5 nmol ¥38,000
MIM0174 hsa-miR-141-3p Mimic UAACACUGUCUGGUAAAGAUGG 5 nmol ¥38,000
INH0174 hsa-miR-141-3p Inhibitor UAACACUGUCUGGUAAAGAUGG 5 nmol ¥38,000
MIM0173 hsa-miR-141-5p Mimic CAUCUUCCAGUACAGUGUUGGA 5 nmol ¥38,000
INH0173 hsa-miR-141-5p Inhibitor CAUCUUCCAGUACAGUGUUGGA 5 nmol ¥38,000
MIM0176 hsa-miR-142-3p Mimic UGUAGUGUUUCCUACUUUAUGGA 5 nmol ¥38,000
INH0176 hsa-miR-142-3p Inhibitor UGUAGUGUUUCCUACUUUAUGGA 5 nmol ¥38,000
MIM0175 hsa-miR-142-5p Mimic CAUAAAGUAGAAAGCACUACU 5 nmol ¥38,000
INH0175 hsa-miR-142-5p Inhibitor CAUAAAGUAGAAAGCACUACU 5 nmol ¥38,000
MIM0178 hsa-miR-143-3p Mimic UGAGAUGAAGCACUGUAGCUC 5 nmol ¥38,000
INH0178 hsa-miR-143-3p Inhibitor UGAGAUGAAGCACUGUAGCUC 5 nmol ¥38,000
MIM0177 hsa-miR-143-5p Mimic GGUGCAGUGCUGCAUCUCUGGU 5 nmol ¥38,000
INH0177 hsa-miR-143-5p Inhibitor GGUGCAGUGCUGCAUCUCUGGU 5 nmol ¥38,000
MIM0180 hsa-miR-144-3p Mimic UACAGUAUAGAUGAUGUACU 5 nmol ¥38,000
INH0180 hsa-miR-144-3p Inhibitor UACAGUAUAGAUGAUGUACU 5 nmol ¥38,000
MIM0179 hsa-miR-144-5p Mimic GGAUAUCAUCAUAUACUGUAAG 5 nmol ¥38,000
INH0179 hsa-miR-144-5p Inhibitor GGAUAUCAUCAUAUACUGUAAG 5 nmol ¥38,000
MIM0181 hsa-miR-145-3p Mimic GGAUUCCUGGAAAUACUGUUCU 5 nmol ¥38,000
INH0181 hsa-miR-145-3p Inhibitor GGAUUCCUGGAAAUACUGUUCU 5 nmol ¥38,000
MIM0182 hsa-miR-145-5p Mimic GUCCAGUUUUCCCAGGAAUCCCU 5 nmol ¥38,000
INH0182 hsa-miR-145-5p Inhibitor GUCCAGUUUUCCCAGGAAUCCCU 5 nmol ¥38,000
MIM0183 hsa-miR-146a-3p Mimic CCUCUGAAAUUCAGUUCUUCAG 5 nmol ¥38,000
INH0183 hsa-miR-146a-3p Inhibitor CCUCUGAAAUUCAGUUCUUCAG 5 nmol ¥38,000
MIM0185 hsa-miR-146a-5p Mimic UGAGAACUGAAUUCCAUGGGUU 5 nmol ¥38,000
INH0185 hsa-miR-146a-5p Inhibitor UGAGAACUGAAUUCCAUGGGUU 5 nmol ¥38,000
MIM0186 hsa-miR-146b-3p Mimic UGCCCUGUGGACUCAGUUCUGG 5 nmol ¥38,000
INH0186 hsa-miR-146b-3p Inhibitor UGCCCUGUGGACUCAGUUCUGG 5 nmol ¥38,000
MIM0184 hsa-miR-146b-5p Mimic UGAGAACUGAAUUCCAUAGGCU 5 nmol ¥38,000
INH0184 hsa-miR-146b-5p Inhibitor UGAGAACUGAAUUCCAUAGGCU 5 nmol ¥38,000
MIM0188 hsa-miR-147a Mimic GUGUGUGGAAAUGCUUCUGC 5 nmol ¥38,000
INH0188 hsa-miR-147a Inhibitor GUGUGUGGAAAUGCUUCUGC 5 nmol ¥38,000
MIM0187 hsa-miR-147b Mimic GUGUGCGGAAAUGCUUCUGCUA 5 nmol ¥38,000
INH0187 hsa-miR-147b Inhibitor GUGUGCGGAAAUGCUUCUGCUA 5 nmol ¥38,000
MIM0191 hsa-miR-148a-3p Mimic UCAGUGCACUACAGAACUUUGU 5 nmol ¥38,000
INH0191 hsa-miR-148a-3p Inhibitor UCAGUGCACUACAGAACUUUGU 5 nmol ¥38,000
MIM0189 hsa-miR-148a-5p Mimic AAAGUUCUGAGACACUCCGACU 5 nmol ¥38,000
INH0189 hsa-miR-148a-5p Inhibitor AAAGUUCUGAGACACUCCGACU 5 nmol ¥38,000
MIM0192 hsa-miR-148b-3p Mimic UCAGUGCAUCACAGAACUUUGU 5 nmol ¥38,000
INH0192 hsa-miR-148b-3p Inhibitor UCAGUGCAUCACAGAACUUUGU 5 nmol ¥38,000
MIM0190 hsa-miR-148b-5p Mimic AAGUUCUGUUAUACACUCAGGC 5 nmol ¥38,000
INH0190 hsa-miR-148b-5p Inhibitor AAGUUCUGUUAUACACUCAGGC 5 nmol ¥38,000
MIM0193 hsa-miR-149-3p Mimic AGGGAGGGACGGGGGCUGUGC 5 nmol ¥38,000
INH0193 hsa-miR-149-3p Inhibitor AGGGAGGGACGGGGGCUGUGC 5 nmol ¥38,000
MIM0194 hsa-miR-149-5p Mimic UCUGGCUCCGUGUCUUCACUCCC 5 nmol ¥38,000
INH0194 hsa-miR-149-5p Inhibitor UCUGGCUCCGUGUCUUCACUCCC 5 nmol ¥38,000
MIM0195 hsa-miR-150-3p Mimic CUGGUACAGGCCUGGGGGACAG 5 nmol ¥38,000
INH0195 hsa-miR-150-3p Inhibitor CUGGUACAGGCCUGGGGGACAG 5 nmol ¥38,000
MIM0196 hsa-miR-150-5p Mimic UCUCCCAACCCUUGUACCAGUG 5 nmol ¥38,000
INH0196 hsa-miR-150-5p Inhibitor UCUCCCAACCCUUGUACCAGUG 5 nmol ¥38,000
MIM0197 hsa-miR-151a-3p Mimic CUAGACUGAAGCUCCUUGAGG 5 nmol ¥38,000
INH0197 hsa-miR-151a-3p Inhibitor CUAGACUGAAGCUCCUUGAGG 5 nmol ¥38,000
MIM0198 hsa-miR-151a-5p Mimic UCGAGGAGCUCACAGUCUAGU 5 nmol ¥38,000
INH0198 hsa-miR-151a-5p Inhibitor UCGAGGAGCUCACAGUCUAGU 5 nmol ¥38,000
MIM0199 hsa-miR-152 Mimic UCAGUGCAUGACAGAACUUGG 5 nmol ¥38,000
INH0199 hsa-miR-152 Inhibitor UCAGUGCAUGACAGAACUUGG 5 nmol ¥38,000
MIM0200 hsa-miR-153 Mimic UUGCAUAGUCACAAAAGUGAUC 5 nmol ¥38,000
INH0200 hsa-miR-153 Inhibitor UUGCAUAGUCACAAAAGUGAUC 5 nmol ¥38,000
MIM0201 hsa-miR-154-3p Mimic AAUCAUACACGGUUGACCUAUU 5 nmol ¥38,000
INH0201 hsa-miR-154-3p Inhibitor AAUCAUACACGGUUGACCUAUU 5 nmol ¥38,000
MIM0202 hsa-miR-154-5p Mimic UAGGUUAUCCGUGUUGCCUUCG 5 nmol ¥38,000
INH0202 hsa-miR-154-5p Inhibitor UAGGUUAUCCGUGUUGCCUUCG 5 nmol ¥38,000
MIM0203 hsa-miR-155-3p Mimic CUCCUACAUAUUAGCAUUAACA 5 nmol ¥38,000
INH0203 hsa-miR-155-3p Inhibitor CUCCUACAUAUUAGCAUUAACA 5 nmol ¥38,000
MIM0204 hsa-miR-155-5p Mimic UUAAUGCUAAUCGUGAUAGGGGU 5 nmol ¥38,000
INH0204 hsa-miR-155-5p Inhibitor UUAAUGCUAAUCGUGAUAGGGGU 5 nmol ¥38,000
MIM0210 hsa-miR-181a-2-3p Mimic ACCACUGACCGUUGACUGUACC 5 nmol ¥38,000
INH0210 hsa-miR-181a-2-3p Inhibitor ACCACUGACCGUUGACUGUACC 5 nmol ¥38,000
MIM0211 hsa-miR-181a-3p Mimic ACCAUCGACCGUUGAUUGUACC 5 nmol ¥38,000
INH0211 hsa-miR-181a-3p Inhibitor ACCAUCGACCGUUGAUUGUACC 5 nmol ¥38,000
MIM0206 hsa-miR-181a-5p Mimic AACAUUCAACGCUGUCGGUGAGU 5 nmol ¥38,000
INH0206 hsa-miR-181a-5p Inhibitor AACAUUCAACGCUGUCGGUGAGU 5 nmol ¥38,000
MIM0207 hsa-miR-181b-5p Mimic AACAUUCAUUGCUGUCGGUGGGU 5 nmol ¥38,000
INH0207 hsa-miR-181b-5p Inhibitor AACAUUCAUUGCUGUCGGUGGGU 5 nmol ¥38,000
MIM0209 hsa-miR-181c-3p Mimic AACCAUCGACCGUUGAGUGGAC 5 nmol ¥38,000
INH0209 hsa-miR-181c-3p Inhibitor AACCAUCGACCGUUGAGUGGAC 5 nmol ¥38,000
MIM0205 hsa-miR-181c-5p Mimic AACAUUCAACCUGUCGGUGAGU 5 nmol ¥38,000
INH0205 hsa-miR-181c-5p Inhibitor AACAUUCAACCUGUCGGUGAGU 5 nmol ¥38,000
MIM0208 hsa-miR-181d Mimic AACAUUCAUUGUUGUCGGUGGGU 5 nmol ¥38,000
INH0208 hsa-miR-181d Inhibitor AACAUUCAUUGUUGUCGGUGGGU 5 nmol ¥38,000
MIM0212 hsa-miR-182-3p Mimic UGGUUCUAGACUUGCCAACUA 5 nmol ¥38,000
INH0212 hsa-miR-182-3p Inhibitor UGGUUCUAGACUUGCCAACUA 5 nmol ¥38,000
MIM0866 hsa-miR-182-5p Mimic UUUGGCAAUGGUAGAACUCACACU 5 nmol ¥38,000
INH0866 hsa-miR-182-5p Inhibitor UUUGGCAAUGGUAGAACUCACACU 5 nmol ¥38,000
MIM0213 hsa-miR-183-3p Mimic GUGAAUUACCGAAGGGCCAUAA 5 nmol ¥38,000
INH0213 hsa-miR-183-3p Inhibitor GUGAAUUACCGAAGGGCCAUAA 5 nmol ¥38,000
MIM0214 hsa-miR-183-5p Mimic UAUGGCACUGGUAGAAUUCACU 5 nmol ¥38,000
INH0214 hsa-miR-183-5p Inhibitor UAUGGCACUGGUAGAAUUCACU 5 nmol ¥38,000
MIM0215 hsa-miR-184 Mimic UGGACGGAGAACUGAUAAGGGU 5 nmol ¥38,000
INH0215 hsa-miR-184 Inhibitor UGGACGGAGAACUGAUAAGGGU 5 nmol ¥38,000
MIM0216 hsa-miR-185-3p Mimic AGGGGCUGGCUUUCCUCUGGUC 5 nmol ¥38,000
INH0216 hsa-miR-185-3p Inhibitor AGGGGCUGGCUUUCCUCUGGUC 5 nmol ¥38,000
MIM0217 hsa-miR-185-5p Mimic UGGAGAGAAAGGCAGUUCCUGA 5 nmol ¥38,000
INH0217 hsa-miR-185-5p Inhibitor UGGAGAGAAAGGCAGUUCCUGA 5 nmol ¥38,000
MIM0219 hsa-miR-186-3p Mimic GCCCAAAGGUGAAUUUUUUGGG 5 nmol ¥38,000
INH0219 hsa-miR-186-3p Inhibitor GCCCAAAGGUGAAUUUUUUGGG 5 nmol ¥38,000
MIM0218 hsa-miR-186-5p Mimic CAAAGAAUUCUCCUUUUGGGCU 5 nmol ¥38,000
INH0218 hsa-miR-186-5p Inhibitor CAAAGAAUUCUCCUUUUGGGCU 5 nmol ¥38,000
MIM0221 hsa-miR-187-3p Mimic UCGUGUCUUGUGUUGCAGCCGG 5 nmol ¥38,000
INH0221 hsa-miR-187-3p Inhibitor UCGUGUCUUGUGUUGCAGCCGG 5 nmol ¥38,000
MIM0220 hsa-miR-187-5p Mimic GGCUACAACACAGGACCCGGGC 5 nmol ¥38,000
INH0220 hsa-miR-187-5p Inhibitor GGCUACAACACAGGACCCGGGC 5 nmol ¥38,000
MIM0223 hsa-miR-188-3p Mimic CUCCCACAUGCAGGGUUUGCA 5 nmol ¥38,000
INH0223 hsa-miR-188-3p Inhibitor CUCCCACAUGCAGGGUUUGCA 5 nmol ¥38,000
MIM0222 hsa-miR-188-5p Mimic CAUCCCUUGCAUGGUGGAGGG 5 nmol ¥38,000
INH0222 hsa-miR-188-5p Inhibitor CAUCCCUUGCAUGGUGGAGGG 5 nmol ¥38,000
MIM0224 hsa-miR-190a Mimic UGAUAUGUUUGAUAUAUUAGGU 5 nmol ¥38,000
INH0224 hsa-miR-190a Inhibitor UGAUAUGUUUGAUAUAUUAGGU 5 nmol ¥38,000
MIM0225 hsa-miR-190b Mimic UGAUAUGUUUGAUAUUGGGUU 5 nmol ¥38,000
INH0225 hsa-miR-190b Inhibitor UGAUAUGUUUGAUAUUGGGUU 5 nmol ¥38,000
MIM0227 hsa-miR-191-3p Mimic GCUGCGCUUGGAUUUCGUCCCC 5 nmol ¥38,000
INH0227 hsa-miR-191-3p Inhibitor GCUGCGCUUGGAUUUCGUCCCC 5 nmol ¥38,000
MIM0226 hsa-miR-191-5p Mimic CAACGGAAUCCCAAAAGCAGCUG 5 nmol ¥38,000
INH0226 hsa-miR-191-5p Inhibitor CAACGGAAUCCCAAAAGCAGCUG 5 nmol ¥38,000
MIM0229 hsa-miR-192-3p Mimic CUGCCAAUUCCAUAGGUCACAG 5 nmol ¥38,000
INH0229 hsa-miR-192-3p Inhibitor CUGCCAAUUCCAUAGGUCACAG 5 nmol ¥38,000
MIM0228 hsa-miR-192-5p Mimic CUGACCUAUGAAUUGACAGCC 5 nmol ¥38,000
INH0228 hsa-miR-192-5p Inhibitor CUGACCUAUGAAUUGACAGCC 5 nmol ¥38,000
MIM0231 hsa-miR-193a-3p Mimic AACUGGCCUACAAAGUCCCAGU 5 nmol ¥38,000
INH0231 hsa-miR-193a-3p Inhibitor AACUGGCCUACAAAGUCCCAGU 5 nmol ¥38,000
MIM0233 hsa-miR-193a-5p Mimic UGGGUCUUUGCGGGCGAGAUGA 5 nmol ¥38,000
INH0233 hsa-miR-193a-5p Inhibitor UGGGUCUUUGCGGGCGAGAUGA 5 nmol ¥38,000
MIM0230 hsa-miR-193b-3p Mimic AACUGGCCCUCAAAGUCCCGCU 5 nmol ¥38,000
INH0230 hsa-miR-193b-3p Inhibitor AACUGGCCCUCAAAGUCCCGCU 5 nmol ¥38,000
MIM0232 hsa-miR-193b-5p Mimic CGGGGUUUUGAGGGCGAGAUGA 5 nmol ¥38,000
INH0232 hsa-miR-193b-5p Inhibitor CGGGGUUUUGAGGGCGAGAUGA 5 nmol ¥38,000
MIM0234 hsa-miR-194-3p Mimic CCAGUGGGGCUGCUGUUAUCUG 5 nmol ¥38,000
INH0234 hsa-miR-194-3p Inhibitor CCAGUGGGGCUGCUGUUAUCUG 5 nmol ¥38,000
MIM0235 hsa-miR-194-5p Mimic UGUAACAGCAACUCCAUGUGGA 5 nmol ¥38,000
INH0235 hsa-miR-194-5p Inhibitor UGUAACAGCAACUCCAUGUGGA 5 nmol ¥38,000
MIM0236 hsa-miR-195-3p Mimic CCAAUAUUGGCUGUGCUGCUCC 5 nmol ¥38,000
INH0236 hsa-miR-195-3p Inhibitor CCAAUAUUGGCUGUGCUGCUCC 5 nmol ¥38,000
MIM0237 hsa-miR-195-5p Mimic UAGCAGCACAGAAAUAUUGGC 5 nmol ¥38,000
INH0237 hsa-miR-195-5p Inhibitor UAGCAGCACAGAAAUAUUGGC 5 nmol ¥38,000
MIM0238 hsa-miR-196a-3p Mimic CGGCAACAAGAAACUGCCUGAG 5 nmol ¥38,000
INH0238 hsa-miR-196a-3p Inhibitor CGGCAACAAGAAACUGCCUGAG 5 nmol ¥38,000
MIM0239 hsa-miR-196a-5p Mimic UAGGUAGUUUCAUGUUGUUGGG 5 nmol ¥38,000
INH0239 hsa-miR-196a-5p Inhibitor UAGGUAGUUUCAUGUUGUUGGG 5 nmol ¥38,000
MIM0241 hsa-miR-196b-3p Mimic UCGACAGCACGACACUGCCUUC 5 nmol ¥38,000
INH0241 hsa-miR-196b-3p Inhibitor UCGACAGCACGACACUGCCUUC 5 nmol ¥38,000
MIM0240 hsa-miR-196b-5p Mimic UAGGUAGUUUCCUGUUGUUGGG 5 nmol ¥38,000
INH0240 hsa-miR-196b-5p Inhibitor UAGGUAGUUUCCUGUUGUUGGG 5 nmol ¥38,000
MIM0242 hsa-miR-197-3p Mimic UUCACCACCUUCUCCACCCAGC 5 nmol ¥38,000
INH0242 hsa-miR-197-3p Inhibitor UUCACCACCUUCUCCACCCAGC 5 nmol ¥38,000
MIM0243 hsa-miR-198 Mimic GGUCCAGAGGGGAGAUAGGUUC 5 nmol ¥38,000
INH0243 hsa-miR-198 Inhibitor GGUCCAGAGGGGAGAUAGGUUC 5 nmol ¥38,000
MIM0244 hsa-miR-199a-3p Mimic ACAGUAGUCUGCACAUUGGUUA 5 nmol ¥38,000
INH0244 hsa-miR-199a-3p Inhibitor ACAGUAGUCUGCACAUUGGUUA 5 nmol ¥38,000
MIM0245 hsa-miR-199a-5p Mimic CCCAGUGUUCAGACUACCUGUUC 5 nmol ¥38,000
INH0245 hsa-miR-199a-5p Inhibitor CCCAGUGUUCAGACUACCUGUUC 5 nmol ¥38,000
MIM0246 hsa-miR-199b-5p Mimic CCCAGUGUUUAGACUAUCUGUUC 5 nmol ¥38,000
INH0246 hsa-miR-199b-5p Inhibitor CCCAGUGUUUAGACUAUCUGUUC 5 nmol ¥38,000