Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items


study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0250 hsa-miR-200a-3p Mimic UAACACUGUCUGGUAACGAUGU 5 nmol ¥38,000
INH0250 hsa-miR-200a-3p Inhibitor UAACACUGUCUGGUAACGAUGU 5 nmol ¥38,000
MIM0247 hsa-miR-200a-5p Mimic CAUCUUACCGGACAGUGCUGGA 5 nmol ¥38,000
INH0247 hsa-miR-200a-5p Inhibitor CAUCUUACCGGACAGUGCUGGA 5 nmol ¥38,000
MIM0252 hsa-miR-200b-3p Mimic UAAUACUGCCUGGUAAUGAUGA 5 nmol ¥38,000
INH0252 hsa-miR-200b-3p Inhibitor UAAUACUGCCUGGUAAUGAUGA 5 nmol ¥38,000
MIM0248 hsa-miR-200b-5p Mimic CAUCUUACUGGGCAGCAUUGGA 5 nmol ¥38,000
INH0248 hsa-miR-200b-5p Inhibitor CAUCUUACUGGGCAGCAUUGGA 5 nmol ¥38,000
MIM0251 hsa-miR-200c-3p Mimic UAAUACUGCCGGGUAAUGAUGGA 5 nmol ¥38,000
INH0251 hsa-miR-200c-3p Inhibitor UAAUACUGCCGGGUAAUGAUGGA 5 nmol ¥38,000
MIM0249 hsa-miR-200c-5p Mimic CGUCUUACCCAGCAGUGUUUGG 5 nmol ¥38,000
INH0249 hsa-miR-200c-5p Inhibitor CGUCUUACCCAGCAGUGUUUGG 5 nmol ¥38,000
MIM0253 hsa-miR-202-3p Mimic AGAGGUAUAGGGCAUGGGAA 5 nmol ¥38,000
INH0253 hsa-miR-202-3p Inhibitor AGAGGUAUAGGGCAUGGGAA 5 nmol ¥38,000
MIM0254 hsa-miR-202-5p Mimic UUCCUAUGCAUAUACUUCUUUG 5 nmol ¥38,000
INH0254 hsa-miR-202-5p Inhibitor UUCCUAUGCAUAUACUUCUUUG 5 nmol ¥38,000
MIM0255 hsa-miR-203 Mimic GUGAAAUGUUUAGGACCACUAG 5 nmol ¥38,000
INH0255 hsa-miR-203 Inhibitor GUGAAAUGUUUAGGACCACUAG 5 nmol ¥38,000
MIM0256 hsa-miR-204-5p Mimic UUCCCUUUGUCAUCCUAUGCCU 5 nmol ¥38,000
INH0256 hsa-miR-204-5p Inhibitor UUCCCUUUGUCAUCCUAUGCCU 5 nmol ¥38,000
MIM0257 hsa-miR-205-3p Mimic GAUUUCAGUGGAGUGAAGUUC 5 nmol ¥38,000
INH0257 hsa-miR-205-3p Inhibitor GAUUUCAGUGGAGUGAAGUUC 5 nmol ¥38,000
MIM0258 hsa-miR-205-5p Mimic UCCUUCAUUCCACCGGAGUCUG 5 nmol ¥38,000
INH0258 hsa-miR-205-5p Inhibitor UCCUUCAUUCCACCGGAGUCUG 5 nmol ¥38,000
MIM0259 hsa-miR-206 Mimic UGGAAUGUAAGGAAGUGUGUGG 5 nmol ¥38,000
INH0259 hsa-miR-206 Inhibitor UGGAAUGUAAGGAAGUGUGUGG 5 nmol ¥38,000
MIM0261 hsa-miR-208a Mimic AUAAGACGAGCAAAAAGCUUGU 5 nmol ¥38,000
INH0261 hsa-miR-208a Inhibitor AUAAGACGAGCAAAAAGCUUGU 5 nmol ¥38,000
MIM0260 hsa-miR-208b Mimic AUAAGACGAACAAAAGGUUUGU 5 nmol ¥38,000
INH0260 hsa-miR-208b Inhibitor AUAAGACGAACAAAAGGUUUGU 5 nmol ¥38,000
MIM0262 hsa-miR-210 Mimic CUGUGCGUGUGACAGCGGCUGA 5 nmol ¥38,000
INH0262 hsa-miR-210 Inhibitor CUGUGCGUGUGACAGCGGCUGA 5 nmol ¥38,000
MIM0263 hsa-miR-211-5p Mimic UUCCCUUUGUCAUCCUUCGCCU 5 nmol ¥38,000
INH0263 hsa-miR-211-5p Inhibitor UUCCCUUUGUCAUCCUUCGCCU 5 nmol ¥38,000
MIM0264 hsa-miR-212-3p Mimic UAACAGUCUCCAGUCACGGCC 5 nmol ¥38,000
INH0264 hsa-miR-212-3p Inhibitor UAACAGUCUCCAGUCACGGCC 5 nmol ¥38,000
MIM0265 hsa-miR-214-3p Mimic ACAGCAGGCACAGACAGGCAGU 5 nmol ¥38,000
INH0265 hsa-miR-214-3p Inhibitor ACAGCAGGCACAGACAGGCAGU 5 nmol ¥38,000
MIM0266 hsa-miR-214-5p Mimic UGCCUGUCUACACUUGCUGUGC 5 nmol ¥38,000
INH0266 hsa-miR-214-5p Inhibitor UGCCUGUCUACACUUGCUGUGC 5 nmol ¥38,000
MIM0267 hsa-miR-215 Mimic AUGACCUAUGAAUUGACAGAC 5 nmol ¥38,000
INH0267 hsa-miR-215 Inhibitor AUGACCUAUGAAUUGACAGAC 5 nmol ¥38,000
MIM0269 hsa-miR-216a Mimic UAAUCUCAGCUGGCAACUGUGA 5 nmol ¥38,000
INH0269 hsa-miR-216a Inhibitor UAAUCUCAGCUGGCAACUGUGA 5 nmol ¥38,000
MIM0268 hsa-miR-216b Mimic AAAUCUCUGCAGGCAAAUGUGA 5 nmol ¥38,000
INH0268 hsa-miR-216b Inhibitor AAAUCUCUGCAGGCAAAUGUGA 5 nmol ¥38,000
MIM0270 hsa-miR-217 Mimic UACUGCAUCAGGAACUGAUUGGA 5 nmol ¥38,000
INH0270 hsa-miR-217 Inhibitor UACUGCAUCAGGAACUGAUUGGA 5 nmol ¥38,000
MIM0271 hsa-miR-218-1-3p Mimic AUGGUUCCGUCAAGCACCAUGG 5 nmol ¥38,000
INH0271 hsa-miR-218-1-3p Inhibitor AUGGUUCCGUCAAGCACCAUGG 5 nmol ¥38,000
MIM0272 hsa-miR-218-2-3p Mimic CAUGGUUCUGUCAAGCACCGCG 5 nmol ¥38,000
INH0272 hsa-miR-218-2-3p Inhibitor CAUGGUUCUGUCAAGCACCGCG 5 nmol ¥38,000
MIM0273 hsa-miR-218-5p Mimic UUGUGCUUGAUCUAACCAUGU 5 nmol ¥38,000
INH0273 hsa-miR-218-5p Inhibitor UUGUGCUUGAUCUAACCAUGU 5 nmol ¥38,000
MIM0275 hsa-miR-219-1-3p Mimic AGAGUUGAGUCUGGACGUCCCG 5 nmol ¥38,000
INH0275 hsa-miR-219-1-3p Inhibitor AGAGUUGAGUCUGGACGUCCCG 5 nmol ¥38,000
MIM0274 hsa-miR-219-2-3p Mimic AGAAUUGUGGCUGGACAUCUGU 5 nmol ¥38,000
INH0274 hsa-miR-219-2-3p Inhibitor AGAAUUGUGGCUGGACAUCUGU 5 nmol ¥38,000
MIM0276 hsa-miR-219-5p Mimic UGAUUGUCCAAACGCAAUUCU 5 nmol ¥38,000
INH0276 hsa-miR-219-5p Inhibitor UGAUUGUCCAAACGCAAUUCU 5 nmol ¥38,000
MIM0281 hsa-miR-221-3p Mimic AGCUACAUUGUCUGCUGGGUUUC 5 nmol ¥38,000
INH0281 hsa-miR-221-3p Inhibitor AGCUACAUUGUCUGCUGGGUUUC 5 nmol ¥38,000
MIM0280 hsa-miR-221-5p Mimic ACCUGGCAUACAAUGUAGAUUU 5 nmol ¥38,000
INH0280 hsa-miR-221-5p Inhibitor ACCUGGCAUACAAUGUAGAUUU 5 nmol ¥38,000
MIM0282 hsa-miR-222-3p Mimic AGCUACAUCUGGCUACUGGGU 5 nmol ¥38,000
INH0282 hsa-miR-222-3p Inhibitor AGCUACAUCUGGCUACUGGGU 5 nmol ¥38,000
MIM0283 hsa-miR-222-5p Mimic CUCAGUAGCCAGUGUAGAUCCU 5 nmol ¥38,000
INH0283 hsa-miR-222-5p Inhibitor CUCAGUAGCCAGUGUAGAUCCU 5 nmol ¥38,000
MIM0285 hsa-miR-223-3p Mimic UGUCAGUUUGUCAAAUACCCCA 5 nmol ¥38,000
INH0285 hsa-miR-223-3p Inhibitor UGUCAGUUUGUCAAAUACCCCA 5 nmol ¥38,000
MIM0284 hsa-miR-223-5p Mimic CGUGUAUUUGACAAGCUGAGUU 5 nmol ¥38,000
INH0284 hsa-miR-223-5p Inhibitor CGUGUAUUUGACAAGCUGAGUU 5 nmol ¥38,000
MIM0286 hsa-miR-224-3p Mimic AAAAUGGUGCCCUAGUGACUACA 5 nmol ¥38,000
INH0286 hsa-miR-224-3p Inhibitor AAAAUGGUGCCCUAGUGACUACA 5 nmol ¥38,000
MIM0287 hsa-miR-224-5p Mimic CAAGUCACUAGUGGUUCCGUU 5 nmol ¥38,000
INH0287 hsa-miR-224-5p Inhibitor CAAGUCACUAGUGGUUCCGUU 5 nmol ¥38,000
MIM0289 hsa-miR-296-3p Mimic GAGGGUUGGGUGGAGGCUCUCC 5 nmol ¥38,000
INH0289 hsa-miR-296-3p Inhibitor GAGGGUUGGGUGGAGGCUCUCC 5 nmol ¥38,000
MIM0288 hsa-miR-296-5p Mimic AGGGCCCCCCCUCAAUCCUGU 5 nmol ¥38,000
INH0288 hsa-miR-296-5p Inhibitor AGGGCCCCCCCUCAAUCCUGU 5 nmol ¥38,000
MIM0290 hsa-miR-297 Mimic AUGUAUGUGUGCAUGUGCAUG 5 nmol ¥38,000
INH0290 hsa-miR-297 Inhibitor AUGUAUGUGUGCAUGUGCAUG 5 nmol ¥38,000
MIM0291 hsa-miR-298 Mimic AGCAGAAGCAGGGAGGUUCUCCCA 5 nmol ¥38,000
INH0291 hsa-miR-298 Inhibitor AGCAGAAGCAGGGAGGUUCUCCCA 5 nmol ¥38,000
MIM0292 hsa-miR-299-3p Mimic UAUGUGGGAUGGUAAACCGCUU 5 nmol ¥38,000
INH0292 hsa-miR-299-3p Inhibitor UAUGUGGGAUGGUAAACCGCUU 5 nmol ¥38,000
MIM0293 hsa-miR-299-5p Mimic UGGUUUACCGUCCCACAUACAU 5 nmol ¥38,000
INH0293 hsa-miR-299-5p Inhibitor UGGUUUACCGUCCCACAUACAU 5 nmol ¥38,000