Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

miR-300...miR-399

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0294 hsa-miR-300 Mimic UAUACAAGGGCAGACUCUCUCU 5 nmol ¥38,000
INH0294 hsa-miR-300 Inhibitor UAUACAAGGGCAGACUCUCUCU 5 nmol ¥38,000
MIM0295 hsa-miR-301a-3p Mimic CAGUGCAAUAGUAUUGUCAAAGC 5 nmol ¥38,000
INH0295 hsa-miR-301a-3p Inhibitor CAGUGCAAUAGUAUUGUCAAAGC 5 nmol ¥38,000
MIM0296 hsa-miR-301b Mimic CAGUGCAAUGAUAUUGUCAAAGC 5 nmol ¥38,000
INH0296 hsa-miR-301b Inhibitor CAGUGCAAUGAUAUUGUCAAAGC 5 nmol ¥38,000
MIM0304 hsa-miR-302a-3p Mimic UAAGUGCUUCCAUGUUUUGGUGA 5 nmol ¥38,000
INH0304 hsa-miR-302a-3p Inhibitor UAAGUGCUUCCAUGUUUUGGUGA 5 nmol ¥38,000
MIM0297 hsa-miR-302a-5p Mimic ACUUAAACGUGGAUGUACUUGCU 5 nmol ¥38,000
INH0297 hsa-miR-302a-5p Inhibitor ACUUAAACGUGGAUGUACUUGCU 5 nmol ¥38,000
MIM0303 hsa-miR-302b-3p Mimic UAAGUGCUUCCAUGUUUUAGUAG 5 nmol ¥38,000
INH0303 hsa-miR-302b-3p Inhibitor UAAGUGCUUCCAUGUUUUAGUAG 5 nmol ¥38,000
MIM0298 hsa-miR-302b-5p Mimic ACUUUAACAUGGAAGUGCUUUC 5 nmol ¥38,000
INH0298 hsa-miR-302b-5p Inhibitor ACUUUAACAUGGAAGUGCUUUC 5 nmol ¥38,000
MIM0301 hsa-miR-302c-3p Mimic UAAGUGCUUCCAUGUUUCAGUGG 5 nmol ¥38,000
INH0301 hsa-miR-302c-3p Inhibitor UAAGUGCUUCCAUGUUUCAGUGG 5 nmol ¥38,000
MIM0306 hsa-miR-302c-5p Mimic UUUAACAUGGGGGUACCUGCUG 5 nmol ¥38,000
INH0306 hsa-miR-302c-5p Inhibitor UUUAACAUGGGGGUACCUGCUG 5 nmol ¥38,000
MIM0302 hsa-miR-302d-3p Mimic UAAGUGCUUCCAUGUUUGAGUGU 5 nmol ¥38,000
INH0302 hsa-miR-302d-3p Inhibitor UAAGUGCUUCCAUGUUUGAGUGU 5 nmol ¥38,000
MIM0299 hsa-miR-302d-5p Mimic ACUUUAACAUGGAGGCACUUGC 5 nmol ¥38,000
INH0299 hsa-miR-302d-5p Inhibitor ACUUUAACAUGGAGGCACUUGC 5 nmol ¥38,000
MIM0300 hsa-miR-302e Mimic UAAGUGCUUCCAUGCUU 5 nmol ¥38,000
INH0300 hsa-miR-302e Inhibitor UAAGUGCUUCCAUGCUU 5 nmol ¥38,000
MIM0305 hsa-miR-302f Mimic UAAUUGCUUCCAUGUUU 5 nmol ¥38,000
INH0305 hsa-miR-302f Inhibitor UAAUUGCUUCCAUGUUU 5 nmol ¥38,000
MIM0309 hsa-miR-320a Mimic AAAAGCUGGGUUGAGAGGGCGA 5 nmol ¥38,000
INH0309 hsa-miR-320a Inhibitor AAAAGCUGGGUUGAGAGGGCGA 5 nmol ¥38,000
MIM0308 hsa-miR-320b Mimic AAAAGCUGGGUUGAGAGGGCAA 5 nmol ¥38,000
INH0308 hsa-miR-320b Inhibitor AAAAGCUGGGUUGAGAGGGCAA 5 nmol ¥38,000
MIM0310 hsa-miR-320c Mimic AAAAGCUGGGUUGAGAGGGU 5 nmol ¥38,000
INH0310 hsa-miR-320c Inhibitor AAAAGCUGGGUUGAGAGGGU 5 nmol ¥38,000
MIM0307 hsa-miR-320d Mimic AAAAGCUGGGUUGAGAGGA 5 nmol ¥38,000
INH0307 hsa-miR-320d Inhibitor AAAAGCUGGGUUGAGAGGA 5 nmol ¥38,000
MIM0312 hsa-miR-323a-3p Mimic CACAUUACACGGUCGACCUCU 5 nmol ¥38,000
INH0312 hsa-miR-323a-3p Inhibitor CACAUUACACGGUCGACCUCU 5 nmol ¥38,000
MIM0311 hsa-miR-323a-5p Mimic AGGUGGUCCGUGGCGCGUUCGC 5 nmol ¥38,000
INH0311 hsa-miR-323a-5p Inhibitor AGGUGGUCCGUGGCGCGUUCGC 5 nmol ¥38,000
MIM0313 hsa-miR-324-3p Mimic ACUGCCCCAGGUGCUGCUGG 5 nmol ¥38,000
INH0313 hsa-miR-324-3p Inhibitor ACUGCCCCAGGUGCUGCUGG 5 nmol ¥38,000
MIM0314 hsa-miR-324-5p Mimic CGCAUCCCCUAGGGCAUUGGUGU 5 nmol ¥38,000
INH0314 hsa-miR-324-5p Inhibitor CGCAUCCCCUAGGGCAUUGGUGU 5 nmol ¥38,000
MIM0315 hsa-miR-325 Mimic CCUAGUAGGUGUCCAGUAAGUGU 5 nmol ¥38,000
INH0315 hsa-miR-325 Inhibitor CCUAGUAGGUGUCCAGUAAGUGU 5 nmol ¥38,000
MIM0316 hsa-miR-326 Mimic CCUCUGGGCCCUUCCUCCAG 5 nmol ¥38,000
INH0316 hsa-miR-326 Inhibitor CCUCUGGGCCCUUCCUCCAG 5 nmol ¥38,000
MIM0317 hsa-miR-328 Mimic CUGGCCCUCUCUGCCCUUCCGU 5 nmol ¥38,000
INH0317 hsa-miR-328 Inhibitor CUGGCCCUCUCUGCCCUUCCGU 5 nmol ¥38,000
MIM0318 hsa-miR-329 Mimic AACACACCUGGUUAACCUCUUU 5 nmol ¥38,000
INH0318 hsa-miR-329 Inhibitor AACACACCUGGUUAACCUCUUU 5 nmol ¥38,000
MIM0319 hsa-miR-330-3p Mimic GCAAAGCACACGGCCUGCAGAGA 5 nmol ¥38,000
INH0319 hsa-miR-330-3p Inhibitor GCAAAGCACACGGCCUGCAGAGA 5 nmol ¥38,000
MIM0320 hsa-miR-330-5p Mimic UCUCUGGGCCUGUGUCUUAGGC 5 nmol ¥38,000
INH0320 hsa-miR-330-5p Inhibitor UCUCUGGGCCUGUGUCUUAGGC 5 nmol ¥38,000
MIM0322 hsa-miR-331-3p Mimic GCCCCUGGGCCUAUCCUAGAA 5 nmol ¥38,000
INH0322 hsa-miR-331-3p Inhibitor GCCCCUGGGCCUAUCCUAGAA 5 nmol ¥38,000
MIM0321 hsa-miR-331-5p Mimic CUAGGUAUGGUCCCAGGGAUCC 5 nmol ¥38,000
INH0321 hsa-miR-331-5p Inhibitor CUAGGUAUGGUCCCAGGGAUCC 5 nmol ¥38,000
MIM0323 hsa-miR-335-5p Mimic UCAAGAGCAAUAACGAAAAAUGU 5 nmol ¥38,000
INH0323 hsa-miR-335-5p Inhibitor UCAAGAGCAAUAACGAAAAAUGU 5 nmol ¥38,000
MIM0324 hsa-miR-337-3p Mimic CUCCUAUAUGAUGCCUUUCUUC 5 nmol ¥38,000
INH0324 hsa-miR-337-3p Inhibitor CUCCUAUAUGAUGCCUUUCUUC 5 nmol ¥38,000
MIM0325 hsa-miR-337-5p Mimic GAACGGCUUCAUACAGGAGUU 5 nmol ¥38,000
INH0325 hsa-miR-337-5p Inhibitor GAACGGCUUCAUACAGGAGUU 5 nmol ¥38,000
MIM0327 hsa-miR-338-3p Mimic UCCAGCAUCAGUGAUUUUGUUG 5 nmol ¥38,000
INH0327 hsa-miR-338-3p Inhibitor UCCAGCAUCAGUGAUUUUGUUG 5 nmol ¥38,000
MIM0326 hsa-miR-338-5p Mimic AACAAUAUCCUGGUGCUGAGUG 5 nmol ¥38,000
INH0326 hsa-miR-338-5p Inhibitor AACAAUAUCCUGGUGCUGAGUG 5 nmol ¥38,000
MIM0329 hsa-miR-339-3p Mimic UGAGCGCCUCGACGACAGAGCCG 5 nmol ¥38,000
INH0329 hsa-miR-339-3p Inhibitor UGAGCGCCUCGACGACAGAGCCG 5 nmol ¥38,000
MIM0328 hsa-miR-339-5p Mimic UCCCUGUCCUCCAGGAGCUCACG 5 nmol ¥38,000
INH0328 hsa-miR-339-5p Inhibitor UCCCUGUCCUCCAGGAGCUCACG 5 nmol ¥38,000
MIM0330 hsa-miR-340-3p Mimic UCCGUCUCAGUUACUUUAUAGC 5 nmol ¥38,000
INH0330 hsa-miR-340-3p Inhibitor UCCGUCUCAGUUACUUUAUAGC 5 nmol ¥38,000
MIM0331 hsa-miR-340-5p Mimic UUAUAAAGCAAUGAGACUGAUU 5 nmol ¥38,000
INH0331 hsa-miR-340-5p Inhibitor UUAUAAAGCAAUGAGACUGAUU 5 nmol ¥38,000
MIM0333 hsa-miR-342-3p Mimic UCUCACACAGAAAUCGCACCCGU 5 nmol ¥38,000
INH0333 hsa-miR-342-3p Inhibitor UCUCACACAGAAAUCGCACCCGU 5 nmol ¥38,000
MIM0332 hsa-miR-342-5p Mimic AGGGGUGCUAUCUGUGAUUGA 5 nmol ¥38,000
INH0332 hsa-miR-342-5p Inhibitor AGGGGUGCUAUCUGUGAUUGA 5 nmol ¥38,000
MIM0334 hsa-miR-345-5p Mimic GCUGACUCCUAGUCCAGGGCUC 5 nmol ¥38,000
INH0334 hsa-miR-345-5p Inhibitor GCUGACUCCUAGUCCAGGGCUC 5 nmol ¥38,000
MIM0335 hsa-miR-346 Mimic UGUCUGCCCGCAUGCCUGCCUCU 5 nmol ¥38,000
INH0335 hsa-miR-346 Inhibitor UGUCUGCCCGCAUGCCUGCCUCU 5 nmol ¥38,000
MIM0336 hsa-miR-361-3p Mimic UCCCCCAGGUGUGAUUCUGAUUU 5 nmol ¥38,000
INH0336 hsa-miR-361-3p Inhibitor UCCCCCAGGUGUGAUUCUGAUUU 5 nmol ¥38,000
MIM0337 hsa-miR-361-5p Mimic UUAUCAGAAUCUCCAGGGGUAC 5 nmol ¥38,000
INH0337 hsa-miR-361-5p Inhibitor UUAUCAGAAUCUCCAGGGGUAC 5 nmol ¥38,000
MIM0338 hsa-miR-362-3p Mimic AACACACCUAUUCAAGGAUUCA 5 nmol ¥38,000
INH0338 hsa-miR-362-3p Inhibitor AACACACCUAUUCAAGGAUUCA 5 nmol ¥38,000
MIM0339 hsa-miR-362-5p Mimic AAUCCUUGGAACCUAGGUGUGAGU 5 nmol ¥38,000
INH0339 hsa-miR-362-5p Inhibitor AAUCCUUGGAACCUAGGUGUGAGU 5 nmol ¥38,000
MIM0340 hsa-miR-363-3p Mimic AAUUGCACGGUAUCCAUCUGUA 5 nmol ¥38,000
INH0340 hsa-miR-363-3p Inhibitor AAUUGCACGGUAUCCAUCUGUA 5 nmol ¥38,000
MIM0341 hsa-miR-363-5p Mimic CGGGUGGAUCACGAUGCAAUUU 5 nmol ¥38,000
INH0341 hsa-miR-363-5p Inhibitor CGGGUGGAUCACGAUGCAAUUU 5 nmol ¥38,000
MIM0343 hsa-miR-365a-3p Mimic UAAUGCCCCUAAAAAUCCUUAU 5 nmol ¥38,000
INH0343 hsa-miR-365a-3p Inhibitor UAAUGCCCCUAAAAAUCCUUAU 5 nmol ¥38,000
MIM0342 hsa-miR-365a-5p Mimic AGGGACUUUUGGGGGCAGAUGUG 5 nmol ¥38,000
INH0342 hsa-miR-365a-5p Inhibitor AGGGACUUUUGGGGGCAGAUGUG 5 nmol ¥38,000
MIM0344 hsa-miR-367-3p Mimic AAUUGCACUUUAGCAAUGGUGA 5 nmol ¥38,000
INH0344 hsa-miR-367-3p Inhibitor AAUUGCACUUUAGCAAUGGUGA 5 nmol ¥38,000
MIM0345 hsa-miR-367-5p Mimic ACUGUUGCUAAUAUGCAACUCU 5 nmol ¥38,000
INH0345 hsa-miR-367-5p Inhibitor ACUGUUGCUAAUAUGCAACUCU 5 nmol ¥38,000
MIM0346 hsa-miR-369-3p Mimic AAUAAUACAUGGUUGAUCUUU 5 nmol ¥38,000
INH0346 hsa-miR-369-3p Inhibitor AAUAAUACAUGGUUGAUCUUU 5 nmol ¥38,000
MIM0347 hsa-miR-369-5p Mimic AGAUCGACCGUGUUAUAUUCGC 5 nmol ¥38,000
INH0347 hsa-miR-369-5p Inhibitor AGAUCGACCGUGUUAUAUUCGC 5 nmol ¥38,000
MIM0348 hsa-miR-370 Mimic GCCUGCUGGGGUGGAACCUGGU 5 nmol ¥38,000
INH0348 hsa-miR-370 Inhibitor GCCUGCUGGGGUGGAACCUGGU 5 nmol ¥38,000
MIM0349 hsa-miR-371a-3p Mimic AAGUGCCGCCAUCUUUUGAGUGU 5 nmol ¥38,000
INH0349 hsa-miR-371a-3p Inhibitor AAGUGCCGCCAUCUUUUGAGUGU 5 nmol ¥38,000
MIM0350 hsa-miR-371a-5p Mimic ACUCAAACUGUGGGGGCACU 5 nmol ¥38,000
INH0350 hsa-miR-371a-5p Inhibitor ACUCAAACUGUGGGGGCACU 5 nmol ¥38,000
MIM0351 hsa-miR-372 Mimic AAAGUGCUGCGACAUUUGAGCGU 5 nmol ¥38,000
INH0351 hsa-miR-372 Inhibitor AAAGUGCUGCGACAUUUGAGCGU 5 nmol ¥38,000
MIM0353 hsa-miR-373-3p Mimic GAAGUGCUUCGAUUUUGGGGUGU 5 nmol ¥38,000
INH0353 hsa-miR-373-3p Inhibitor GAAGUGCUUCGAUUUUGGGGUGU 5 nmol ¥38,000
MIM0352 hsa-miR-373-5p Mimic ACUCAAAAUGGGGGCGCUUUCC 5 nmol ¥38,000
INH0352 hsa-miR-373-5p Inhibitor ACUCAAAAUGGGGGCGCUUUCC 5 nmol ¥38,000
MIM0356 hsa-miR-374a-3p Mimic CUUAUCAGAUUGUAUUGUAAUU 5 nmol ¥38,000
INH0356 hsa-miR-374a-3p Inhibitor CUUAUCAGAUUGUAUUGUAAUU 5 nmol ¥38,000
MIM0357 hsa-miR-374a-5p Mimic UUAUAAUACAACCUGAUAAGUG 5 nmol ¥38,000
INH0357 hsa-miR-374a-5p Inhibitor UUAUAAUACAACCUGAUAAGUG 5 nmol ¥38,000
MIM0355 hsa-miR-374b-3p Mimic CUUAGCAGGUUGUAUUAUCAUU 5 nmol ¥38,000
INH0355 hsa-miR-374b-3p Inhibitor CUUAGCAGGUUGUAUUAUCAUU 5 nmol ¥38,000
MIM0354 hsa-miR-374b-5p Mimic AUAUAAUACAACCUGCUAAGUG 5 nmol ¥38,000
INH0354 hsa-miR-374b-5p Inhibitor AUAUAAUACAACCUGCUAAGUG 5 nmol ¥38,000
MIM0865 hsa-miR-375 Mimic UUUGUUCGUUCGGCUCGCGUGA 5 nmol ¥38,000
INH0865 hsa-miR-375 Inhibitor UUUGUUCGUUCGGCUCGCGUGA 5 nmol ¥38,000
MIM0359 hsa-miR-376a-3p Mimic AUCAUAGAGGAAAAUCCACGU 5 nmol ¥38,000
INH0359 hsa-miR-376a-3p Inhibitor AUCAUAGAGGAAAAUCCACGU 5 nmol ¥38,000
MIM0361 hsa-miR-376a-5p Mimic GUAGAUUCUCCUUCUAUGAGUA 5 nmol ¥38,000
INH0361 hsa-miR-376a-5p Inhibitor GUAGAUUCUCCUUCUAUGAGUA 5 nmol ¥38,000
MIM0360 hsa-miR-376b Mimic AUCAUAGAGGAAAAUCCAUGUU 5 nmol ¥38,000
INH0360 hsa-miR-376b Inhibitor AUCAUAGAGGAAAAUCCAUGUU 5 nmol ¥38,000
MIM0358 hsa-miR-376c Mimic AACAUAGAGGAAAUUCCACGU 5 nmol ¥38,000
INH0358 hsa-miR-376c Inhibitor AACAUAGAGGAAAUUCCACGU 5 nmol ¥38,000
MIM0363 hsa-miR-377-3p Mimic AUCACACAAAGGCAACUUUUGU 5 nmol ¥38,000
INH0363 hsa-miR-377-3p Inhibitor AUCACACAAAGGCAACUUUUGU 5 nmol ¥38,000
MIM0362 hsa-miR-377-5p Mimic AGAGGUUGCCCUUGGUGAAUUC 5 nmol ¥38,000
INH0362 hsa-miR-377-5p Inhibitor AGAGGUUGCCCUUGGUGAAUUC 5 nmol ¥38,000
MIM0364 hsa-miR-378a-3p Mimic ACUGGACUUGGAGUCAGAAGG 5 nmol ¥38,000
INH0364 hsa-miR-378a-3p Inhibitor ACUGGACUUGGAGUCAGAAGG 5 nmol ¥38,000
MIM0365 hsa-miR-378a-5p Mimic CUCCUGACUCCAGGUCCUGUGU 5 nmol ¥38,000
INH0365 hsa-miR-378a-5p Inhibitor CUCCUGACUCCAGGUCCUGUGU 5 nmol ¥38,000
MIM0366 hsa-miR-379-3p Mimic UAUGUAACAUGGUCCACUAACU 5 nmol ¥38,000
INH0366 hsa-miR-379-3p Inhibitor UAUGUAACAUGGUCCACUAACU 5 nmol ¥38,000
MIM0367 hsa-miR-379-5p Mimic UGGUAGACUAUGGAACGUAGG 5 nmol ¥38,000
INH0367 hsa-miR-379-5p Inhibitor UGGUAGACUAUGGAACGUAGG 5 nmol ¥38,000
MIM0368 hsa-miR-380-3p Mimic UAUGUAAUAUGGUCCACAUCUU 5 nmol ¥38,000
INH0368 hsa-miR-380-3p Inhibitor UAUGUAAUAUGGUCCACAUCUU 5 nmol ¥38,000
MIM0369 hsa-miR-380-5p Mimic UGGUUGACCAUAGAACAUGCGC 5 nmol ¥38,000
INH0369 hsa-miR-380-5p Inhibitor UGGUUGACCAUAGAACAUGCGC 5 nmol ¥38,000
MIM0370 hsa-miR-381 Mimic UAUACAAGGGCAAGCUCUCUGU 5 nmol ¥38,000
INH0370 hsa-miR-381 Inhibitor UAUACAAGGGCAAGCUCUCUGU 5 nmol ¥38,000
MIM0371 hsa-miR-382-5p Mimic GAAGUUGUUCGUGGUGGAUUCG 5 nmol ¥38,000
INH0371 hsa-miR-382-5p Inhibitor GAAGUUGUUCGUGGUGGAUUCG 5 nmol ¥38,000
MIM0372 hsa-miR-383 Mimic AGAUCAGAAGGUGAUUGUGGCU 5 nmol ¥38,000
INH0372 hsa-miR-383 Inhibitor AGAUCAGAAGGUGAUUGUGGCU 5 nmol ¥38,000
MIM0373 hsa-miR-384 Mimic AUUCCUAGAAAUUGUUCAUA 5 nmol ¥38,000
INH0373 hsa-miR-384 Inhibitor AUUCCUAGAAAUUGUUCAUA 5 nmol ¥38,000