Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items


study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0674 hsa-miR-708-3p Mimic CAACUAGACUGUGAGCUUCUAG 5 nmol ¥38,000
INH0674 hsa-miR-708-3p Inhibitor CAACUAGACUGUGAGCUUCUAG 5 nmol ¥38,000
MIM0673 hsa-miR-708-5p Mimic AAGGAGCUUACAAUCUAGCUGGG 5 nmol ¥38,000
INH0673 hsa-miR-708-5p Inhibitor AAGGAGCUUACAAUCUAGCUGGG 5 nmol ¥38,000
MIM0675 hsa-miR-720 Mimic UCUCGCUGGGGCCUCCA 5 nmol ¥38,000
INH0675 hsa-miR-720 Inhibitor UCUCGCUGGGGCCUCCA 5 nmol ¥38,000
MIM0676 hsa-miR-744-3p Mimic CUGUUGCCACUAACCUCAACCU 5 nmol ¥38,000
INH0676 hsa-miR-744-3p Inhibitor CUGUUGCCACUAACCUCAACCU 5 nmol ¥38,000
MIM0677 hsa-miR-744-5p Mimic UGCGGGGCUAGGGCUAACAGCA 5 nmol ¥38,000
INH0677 hsa-miR-744-5p Inhibitor UGCGGGGCUAGGGCUAACAGCA 5 nmol ¥38,000
MIM0678 hsa-miR-760 Mimic CGGCUCUGGGUCUGUGGGGA 5 nmol ¥38,000
INH0678 hsa-miR-760 Inhibitor CGGCUCUGGGUCUGUGGGGA 5 nmol ¥38,000
MIM0679 hsa-miR-765 Mimic UGGAGGAGAAGGAAGGUGAUG 5 nmol ¥38,000
INH0679 hsa-miR-765 Inhibitor UGGAGGAGAAGGAAGGUGAUG 5 nmol ¥38,000
MIM0680 hsa-miR-766-3p Mimic ACUCCAGCCCCACAGCCUCAGC 5 nmol ¥38,000
INH0680 hsa-miR-766-3p Inhibitor ACUCCAGCCCCACAGCCUCAGC 5 nmol ¥38,000
MIM0681 hsa-miR-767-3p Mimic UCUGCUCAUACCCCAUGGUUUCU 5 nmol ¥38,000
INH0681 hsa-miR-767-3p Inhibitor UCUGCUCAUACCCCAUGGUUUCU 5 nmol ¥38,000
MIM0682 hsa-miR-767-5p Mimic UGCACCAUGGUUGUCUGAGCAUG 5 nmol ¥38,000
INH0682 hsa-miR-767-5p Inhibitor UGCACCAUGGUUGUCUGAGCAUG 5 nmol ¥38,000
MIM0683 hsa-miR-769-3p Mimic CUGGGAUCUCCGGGGUCUUGGUU 5 nmol ¥38,000
INH0683 hsa-miR-769-3p Inhibitor CUGGGAUCUCCGGGGUCUUGGUU 5 nmol ¥38,000
MIM0684 hsa-miR-769-5p Mimic UGAGACCUCUGGGUUCUGAGCU 5 nmol ¥38,000
INH0684 hsa-miR-769-5p Inhibitor UGAGACCUCUGGGUUCUGAGCU 5 nmol ¥38,000
MIM0685 hsa-miR-770-5p Mimic UCCAGUACCACGUGUCAGGGCCA 5 nmol ¥38,000
INH0685 hsa-miR-770-5p Inhibitor UCCAGUACCACGUGUCAGGGCCA 5 nmol ¥38,000
MIM0686 hsa-miR-802 Mimic CAGUAACAAAGAUUCAUCCUUGU 5 nmol ¥38,000
INH0686 hsa-miR-802 Inhibitor CAGUAACAAAGAUUCAUCCUUGU 5 nmol ¥38,000
MIM0687 hsa-miR-873-5p Mimic GCAGGAACUUGUGAGUCUCCU 5 nmol ¥38,000
INH0687 hsa-miR-873-5p Inhibitor GCAGGAACUUGUGAGUCUCCU 5 nmol ¥38,000
MIM0688 hsa-miR-874 Mimic CUGCCCUGGCCCGAGGGACCGA 5 nmol ¥38,000
INH0688 hsa-miR-874 Inhibitor CUGCCCUGGCCCGAGGGACCGA 5 nmol ¥38,000
MIM0689 hsa-miR-875-3p Mimic CCUGGAAACACUGAGGUUGUG 5 nmol ¥38,000
INH0689 hsa-miR-875-3p Inhibitor CCUGGAAACACUGAGGUUGUG 5 nmol ¥38,000
MIM0690 hsa-miR-875-5p Mimic UAUACCUCAGUUUUAUCAGGUG 5 nmol ¥38,000
INH0690 hsa-miR-875-5p Inhibitor UAUACCUCAGUUUUAUCAGGUG 5 nmol ¥38,000
MIM0692 hsa-miR-876-3p Mimic UGGUGGUUUACAAAGUAAUUCA 5 nmol ¥38,000
INH0692 hsa-miR-876-3p Inhibitor UGGUGGUUUACAAAGUAAUUCA 5 nmol ¥38,000
MIM0691 hsa-miR-876-5p Mimic UGGAUUUCUUUGUGAAUCACCA 5 nmol ¥38,000
INH0691 hsa-miR-876-5p Inhibitor UGGAUUUCUUUGUGAAUCACCA 5 nmol ¥38,000
MIM0694 hsa-miR-877-3p Mimic UCCUCUUCUCCCUCCUCCCAG 5 nmol ¥38,000
INH0694 hsa-miR-877-3p Inhibitor UCCUCUUCUCCCUCCUCCCAG 5 nmol ¥38,000
MIM0693 hsa-miR-877-5p Mimic GUAGAGGAGAUGGCGCAGGG 5 nmol ¥38,000
INH0693 hsa-miR-877-5p Inhibitor GUAGAGGAGAUGGCGCAGGG 5 nmol ¥38,000
MIM0695 hsa-miR-885-3p Mimic AGGCAGCGGGGUGUAGUGGAUA 5 nmol ¥38,000
INH0695 hsa-miR-885-3p Inhibitor AGGCAGCGGGGUGUAGUGGAUA 5 nmol ¥38,000
MIM0696 hsa-miR-885-5p Mimic UCCAUUACACUACCCUGCCUCU 5 nmol ¥38,000
INH0696 hsa-miR-885-5p Inhibitor UCCAUUACACUACCCUGCCUCU 5 nmol ¥38,000
MIM0699 hsa-miR-887 Mimic GUGAACGGGCGCCAUCCCGAGG 5 nmol ¥38,000
INH0699 hsa-miR-887 Inhibitor GUGAACGGGCGCCAUCCCGAGG 5 nmol ¥38,000
MIM0700 hsa-miR-888-3p Mimic GACUGACACCUCUUUGGGUGAA 5 nmol ¥38,000
INH0700 hsa-miR-888-3p Inhibitor GACUGACACCUCUUUGGGUGAA 5 nmol ¥38,000
MIM0701 hsa-miR-888-5p Mimic UACUCAAAAAGCUGUCAGUCA 5 nmol ¥38,000
INH0701 hsa-miR-888-5p Inhibitor UACUCAAAAAGCUGUCAGUCA 5 nmol ¥38,000
MIM0702 hsa-miR-889 Mimic UUAAUAUCGGACAACCAUUGU 5 nmol ¥38,000
INH0702 hsa-miR-889 Inhibitor UUAAUAUCGGACAACCAUUGU 5 nmol ¥38,000
MIM0703 hsa-miR-890 Mimic UACUUGGAAAGGCAUCAGUUG 5 nmol ¥38,000
INH0703 hsa-miR-890 Inhibitor UACUUGGAAAGGCAUCAGUUG 5 nmol ¥38,000
MIM0704 hsa-miR-891a Mimic UGCAACGAACCUGAGCCACUGA 5 nmol ¥38,000
INH0704 hsa-miR-891a Inhibitor UGCAACGAACCUGAGCCACUGA 5 nmol ¥38,000
MIM0705 hsa-miR-891b Mimic UGCAACUUACCUGAGUCAUUGA 5 nmol ¥38,000
INH0705 hsa-miR-891b Inhibitor UGCAACUUACCUGAGUCAUUGA 5 nmol ¥38,000
MIM0707 hsa-miR-892a Mimic CACUGUGUCCUUUCUGCGUAG 5 nmol ¥38,000
INH0707 hsa-miR-892a Inhibitor CACUGUGUCCUUUCUGCGUAG 5 nmol ¥38,000
MIM0706 hsa-miR-892b Mimic CACUGGCUCCUUUCUGGGUAGA 5 nmol ¥38,000
INH0706 hsa-miR-892b Inhibitor CACUGGCUCCUUUCUGGGUAGA 5 nmol ¥38,000
MIM0708 hsa-miR-920 Mimic GGGGAGCUGUGGAAGCAGUA 5 nmol ¥38,000
INH0708 hsa-miR-920 Inhibitor GGGGAGCUGUGGAAGCAGUA 5 nmol ¥38,000
MIM0709 hsa-miR-921 Mimic CUAGUGAGGGACAGAACCAGGAUUC 5 nmol ¥38,000
INH0709 hsa-miR-921 Inhibitor CUAGUGAGGGACAGAACCAGGAUUC 5 nmol ¥38,000
MIM0710 hsa-miR-922 Mimic GCAGCAGAGAAUAGGACUACGUC 5 nmol ¥38,000
INH0710 hsa-miR-922 Inhibitor GCAGCAGAGAAUAGGACUACGUC 5 nmol ¥38,000
MIM0711 hsa-miR-924 Mimic AGAGUCUUGUGAUGUCUUGC 5 nmol ¥38,000
INH0711 hsa-miR-924 Inhibitor AGAGUCUUGUGAUGUCUUGC 5 nmol ¥38,000
MIM0712 hsa-miR-933 Mimic UGUGCGCAGGGAGACCUCUCCC 5 nmol ¥38,000
INH0712 hsa-miR-933 Inhibitor UGUGCGCAGGGAGACCUCUCCC 5 nmol ¥38,000
MIM0713 hsa-miR-934 Mimic UGUCUACUACUGGAGACACUGG 5 nmol ¥38,000
INH0713 hsa-miR-934 Inhibitor UGUCUACUACUGGAGACACUGG 5 nmol ¥38,000
MIM0714 hsa-miR-935 Mimic CCAGUUACCGCUUCCGCUACCGC 5 nmol ¥38,000
INH0714 hsa-miR-935 Inhibitor CCAGUUACCGCUUCCGCUACCGC 5 nmol ¥38,000
MIM0715 hsa-miR-936 Mimic ACAGUAGAGGGAGGAAUCGCAG 5 nmol ¥38,000
INH0715 hsa-miR-936 Inhibitor ACAGUAGAGGGAGGAAUCGCAG 5 nmol ¥38,000
MIM0716 hsa-miR-937 Mimic AUCCGCGCUCUGACUCUCUGCC 5 nmol ¥38,000
INH0716 hsa-miR-937 Inhibitor AUCCGCGCUCUGACUCUCUGCC 5 nmol ¥38,000
MIM0717 hsa-miR-938 Mimic UGCCCUUAAAGGUGAACCCAGU 5 nmol ¥38,000
INH0717 hsa-miR-938 Inhibitor UGCCCUUAAAGGUGAACCCAGU 5 nmol ¥38,000
MIM0718 hsa-miR-939 Mimic UGGGGAGCUGAGGCUCUGGGGGUG 5 nmol ¥38,000
INH0718 hsa-miR-939 Inhibitor UGGGGAGCUGAGGCUCUGGGGGUG 5 nmol ¥38,000
MIM0719 hsa-miR-940 Mimic AAGGCAGGGCCCCCGCUCCCC 5 nmol ¥38,000
INH0719 hsa-miR-940 Inhibitor AAGGCAGGGCCCCCGCUCCCC 5 nmol ¥38,000
MIM0720 hsa-miR-941 Mimic CACCCGGCUGUGUGCACAUGUGC 5 nmol ¥38,000
INH0720 hsa-miR-941 Inhibitor CACCCGGCUGUGUGCACAUGUGC 5 nmol ¥38,000
MIM0721 hsa-miR-942 Mimic UCUUCUCUGUUUUGGCCAUGUG 5 nmol ¥38,000
INH0721 hsa-miR-942 Inhibitor UCUUCUCUGUUUUGGCCAUGUG 5 nmol ¥38,000
MIM0722 hsa-miR-943 Mimic CUGACUGUUGCCGUCCUCCAG 5 nmol ¥38,000
INH0722 hsa-miR-943 Inhibitor CUGACUGUUGCCGUCCUCCAG 5 nmol ¥38,000
MIM0723 hsa-miR-944 Mimic AAAUUAUUGUACAUCGGAUGAG 5 nmol ¥38,000
INH0723 hsa-miR-944 Inhibitor AAAUUAUUGUACAUCGGAUGAG 5 nmol ¥38,000