Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

miR-1000...miR-2300

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0724 hsa-miR-1178 Mimic UUGCUCACUGUUCUUCCCUAG 5 nmol ¥38,000
INH0724 hsa-miR-1178 Inhibitor UUGCUCACUGUUCUUCCCUAG 5 nmol ¥38,000
MIM0725 hsa-miR-1179 Mimic AAGCAUUCUUUCAUUGGUUGG 5 nmol ¥38,000
INH0725 hsa-miR-1179 Inhibitor AAGCAUUCUUUCAUUGGUUGG 5 nmol ¥38,000
MIM0726 hsa-miR-1181 Mimic CCGUCGCCGCCACCCGAGCCG 5 nmol ¥38,000
INH0726 hsa-miR-1181 Inhibitor CCGUCGCCGCCACCCGAGCCG 5 nmol ¥38,000
MIM0727 hsa-miR-1182 Mimic GAGGGUCUUGGGAGGGAUGUGAC 5 nmol ¥38,000
INH0727 hsa-miR-1182 Inhibitor GAGGGUCUUGGGAGGGAUGUGAC 5 nmol ¥38,000
MIM0728 hsa-miR-1183 Mimic CACUGUAGGUGAUGGUGAGAGUGGGCA 5 nmol ¥38,000
INH0728 hsa-miR-1183 Inhibitor CACUGUAGGUGAUGGUGAGAGUGGGCA 5 nmol ¥38,000
MIM0729 hsa-miR-1184 Mimic CCUGCAGCGACUUGAUGGCUUCC 5 nmol ¥38,000
INH0729 hsa-miR-1184 Inhibitor CCUGCAGCGACUUGAUGGCUUCC 5 nmol ¥38,000
MIM0730 hsa-miR-1185-5p Mimic AGAGGAUACCCUUUGUAUGUU 5 nmol ¥38,000
INH0730 hsa-miR-1185-5p Inhibitor AGAGGAUACCCUUUGUAUGUU 5 nmol ¥38,000
MIM0731 hsa-miR-1197 Mimic UAGGACACAUGGUCUACUUCU 5 nmol ¥38,000
INH0731 hsa-miR-1197 Inhibitor UAGGACACAUGGUCUACUUCU 5 nmol ¥38,000
MIM0732 hsa-miR-1200 Mimic CUCCUGAGCCAUUCUGAGCCUC 5 nmol ¥38,000
INH0732 hsa-miR-1200 Inhibitor CUCCUGAGCCAUUCUGAGCCUC 5 nmol ¥38,000
MIM0734 hsa-miR-1202 Mimic GUGCCAGCUGCAGUGGGGGAG 5 nmol ¥38,000
INH0734 hsa-miR-1202 Inhibitor GUGCCAGCUGCAGUGGGGGAG 5 nmol ¥38,000
MIM0735 hsa-miR-1203 Mimic CCCGGAGCCAGGAUGCAGCUC 5 nmol ¥38,000
INH0735 hsa-miR-1203 Inhibitor CCCGGAGCCAGGAUGCAGCUC 5 nmol ¥38,000
MIM0736 hsa-miR-1204 Mimic UCGUGGCCUGGUCUCCAUUAU 5 nmol ¥38,000
INH0736 hsa-miR-1204 Inhibitor UCGUGGCCUGGUCUCCAUUAU 5 nmol ¥38,000
MIM0737 hsa-miR-1205 Mimic UCUGCAGGGUUUGCUUUGAG 5 nmol ¥38,000
INH0737 hsa-miR-1205 Inhibitor UCUGCAGGGUUUGCUUUGAG 5 nmol ¥38,000
MIM0738 hsa-miR-1206 Mimic UGUUCAUGUAGAUGUUUAAGC 5 nmol ¥38,000
INH0738 hsa-miR-1206 Inhibitor UGUUCAUGUAGAUGUUUAAGC 5 nmol ¥38,000
MIM0739 hsa-miR-1207-3p Mimic UCAGCUGGCCCUCAUUUC 5 nmol ¥38,000
INH0739 hsa-miR-1207-3p Inhibitor UCAGCUGGCCCUCAUUUC 5 nmol ¥38,000
MIM0740 hsa-miR-1207-5p Mimic UGGCAGGGAGGCUGGGAGGGG 5 nmol ¥38,000
INH0740 hsa-miR-1207-5p Inhibitor UGGCAGGGAGGCUGGGAGGGG 5 nmol ¥38,000
MIM0741 hsa-miR-1208 Mimic UCACUGUUCAGACAGGCGGA 5 nmol ¥38,000
INH0741 hsa-miR-1208 Inhibitor UCACUGUUCAGACAGGCGGA 5 nmol ¥38,000
MIM0742 hsa-miR-1224-3p Mimic CCCCACCUCCUCUCUCCUCAG 5 nmol ¥38,000
INH0742 hsa-miR-1224-3p Inhibitor CCCCACCUCCUCUCUCCUCAG 5 nmol ¥38,000
MIM0743 hsa-miR-1224-5p Mimic GUGAGGACUCGGGAGGUGG 5 nmol ¥38,000
INH0743 hsa-miR-1224-5p Inhibitor GUGAGGACUCGGGAGGUGG 5 nmol ¥38,000
MIM0745 hsa-miR-1225-3p Mimic UGAGCCCCUGUGCCGCCCCCAG 5 nmol ¥38,000
INH0745 hsa-miR-1225-3p Inhibitor UGAGCCCCUGUGCCGCCCCCAG 5 nmol ¥38,000
MIM0744 hsa-miR-1225-5p Mimic GUGGGUACGGCCCAGUGGGGGG 5 nmol ¥38,000
INH0744 hsa-miR-1225-5p Inhibitor GUGGGUACGGCCCAGUGGGGGG 5 nmol ¥38,000
MIM0747 hsa-miR-1226-3p Mimic UCACCAGCCCUGUGUUCCCUAG 5 nmol ¥38,000
INH0747 hsa-miR-1226-3p Inhibitor UCACCAGCCCUGUGUUCCCUAG 5 nmol ¥38,000
MIM0746 hsa-miR-1226-5p Mimic GUGAGGGCAUGCAGGCCUGGAUGGGG 5 nmol ¥38,000
INH0746 hsa-miR-1226-5p Inhibitor GUGAGGGCAUGCAGGCCUGGAUGGGG 5 nmol ¥38,000
MIM0748 hsa-miR-1227 Mimic CGUGCCACCCUUUUCCCCAG 5 nmol ¥38,000
INH0748 hsa-miR-1227 Inhibitor CGUGCCACCCUUUUCCCCAG 5 nmol ¥38,000
MIM0750 hsa-miR-1228-3p Mimic UCACACCUGCCUCGCCCCCC 5 nmol ¥38,000
INH0750 hsa-miR-1228-3p Inhibitor UCACACCUGCCUCGCCCCCC 5 nmol ¥38,000
MIM0749 hsa-miR-1228-5p Mimic GUGGGCGGGGGCAGGUGUGUG 5 nmol ¥38,000
INH0749 hsa-miR-1228-5p Inhibitor GUGGGCGGGGGCAGGUGUGUG 5 nmol ¥38,000
MIM0751 hsa-miR-1229 Mimic CUCUCACCACUGCCCUCCCACAG 5 nmol ¥38,000
INH0751 hsa-miR-1229 Inhibitor CUCUCACCACUGCCCUCCCACAG 5 nmol ¥38,000
MIM0752 hsa-miR-1231 Mimic GUGUCUGGGCGGACAGCUGC 5 nmol ¥38,000
INH0752 hsa-miR-1231 Inhibitor GUGUCUGGGCGGACAGCUGC 5 nmol ¥38,000
MIM0753 hsa-miR-1233 Mimic UGAGCCCUGUCCUCCCGCAG 5 nmol ¥38,000
INH0753 hsa-miR-1233 Inhibitor UGAGCCCUGUCCUCCCGCAG 5 nmol ¥38,000
MIM0754 hsa-miR-1234 Mimic UCGGCCUGACCACCCACCCCAC 5 nmol ¥38,000
INH0754 hsa-miR-1234 Inhibitor UCGGCCUGACCACCCACCCCAC 5 nmol ¥38,000
MIM0755 hsa-miR-1236 Mimic CCUCUUCCCCUUGUCUCUCCAG 5 nmol ¥38,000
INH0755 hsa-miR-1236 Inhibitor CCUCUUCCCCUUGUCUCUCCAG 5 nmol ¥38,000
MIM0756 hsa-miR-1237 Mimic UCCUUCUGCUCCGUCCCCCAG 5 nmol ¥38,000
INH0756 hsa-miR-1237 Inhibitor UCCUUCUGCUCCGUCCCCCAG 5 nmol ¥38,000
MIM0757 hsa-miR-1238 Mimic CUUCCUCGUCUGUCUGCCCC 5 nmol ¥38,000
INH0757 hsa-miR-1238 Inhibitor CUUCCUCGUCUGUCUGCCCC 5 nmol ¥38,000
MIM0758 hsa-miR-1243 Mimic AACUGGAUCAAUUAUAGGAGUG 5 nmol ¥38,000
INH0758 hsa-miR-1243 Inhibitor AACUGGAUCAAUUAUAGGAGUG 5 nmol ¥38,000
MIM0759 hsa-miR-1244 Mimic AAGUAGUUGGUUUGUAUGAGAUGGUU 5 nmol ¥38,000
INH0759 hsa-miR-1244 Inhibitor AAGUAGUUGGUUUGUAUGAGAUGGUU 5 nmol ¥38,000
MIM0760 hsa-miR-1245a Mimic AAGUGAUCUAAAGGCCUACAU 5 nmol ¥38,000
INH0760 hsa-miR-1245a Inhibitor AAGUGAUCUAAAGGCCUACAU 5 nmol ¥38,000
MIM0761 hsa-miR-1246 Mimic AAUGGAUUUUUGGAGCAGG 5 nmol ¥38,000
INH0761 hsa-miR-1246 Inhibitor AAUGGAUUUUUGGAGCAGG 5 nmol ¥38,000
MIM0762 hsa-miR-1247-5p Mimic ACCCGUCCCGUUCGUCCCCGGA 5 nmol ¥38,000
INH0762 hsa-miR-1247-5p Inhibitor ACCCGUCCCGUUCGUCCCCGGA 5 nmol ¥38,000
MIM0763 hsa-miR-1248 Mimic ACCUUCUUGUAUAAGCACUGUGCUAAA 5 nmol ¥38,000
INH0763 hsa-miR-1248 Inhibitor ACCUUCUUGUAUAAGCACUGUGCUAAA 5 nmol ¥38,000
MIM0764 hsa-miR-1249 Mimic ACGCCCUUCCCCCCCUUCUUCA 5 nmol ¥38,000
INH0764 hsa-miR-1249 Inhibitor ACGCCCUUCCCCCCCUUCUUCA 5 nmol ¥38,000
MIM0765 hsa-miR-1250 Mimic ACGGUGCUGGAUGUGGCCUUU 5 nmol ¥38,000
INH0765 hsa-miR-1250 Inhibitor ACGGUGCUGGAUGUGGCCUUU 5 nmol ¥38,000
MIM0766 hsa-miR-1251 Mimic ACUCUAGCUGCCAAAGGCGCU 5 nmol ¥38,000
INH0766 hsa-miR-1251 Inhibitor ACUCUAGCUGCCAAAGGCGCU 5 nmol ¥38,000
MIM0767 hsa-miR-1252 Mimic AGAAGGAAAUUGAAUUCAUUUA 5 nmol ¥38,000
INH0767 hsa-miR-1252 Inhibitor AGAAGGAAAUUGAAUUCAUUUA 5 nmol ¥38,000
MIM0768 hsa-miR-1253 Mimic AGAGAAGAAGAUCAGCCUGCA 5 nmol ¥38,000
INH0768 hsa-miR-1253 Inhibitor AGAGAAGAAGAUCAGCCUGCA 5 nmol ¥38,000
MIM0769 hsa-miR-1254 Mimic AGCCUGGAAGCUGGAGCCUGCAGU 5 nmol ¥38,000
INH0769 hsa-miR-1254 Inhibitor AGCCUGGAAGCUGGAGCCUGCAGU 5 nmol ¥38,000
MIM0770 hsa-miR-1255a Mimic AGGAUGAGCAAAGAAAGUAGAUU 5 nmol ¥38,000
INH0770 hsa-miR-1255a Inhibitor AGGAUGAGCAAAGAAAGUAGAUU 5 nmol ¥38,000
MIM0771 hsa-miR-1255b-5p Mimic CGGAUGAGCAAAGAAAGUGGUU 5 nmol ¥38,000
INH0771 hsa-miR-1255b-5p Inhibitor CGGAUGAGCAAAGAAAGUGGUU 5 nmol ¥38,000
MIM0772 hsa-miR-1256 Mimic AGGCAUUGACUUCUCACUAGCU 5 nmol ¥38,000
INH0772 hsa-miR-1256 Inhibitor AGGCAUUGACUUCUCACUAGCU 5 nmol ¥38,000
MIM0773 hsa-miR-1257 Mimic AGUGAAUGAUGGGUUCUGACC 5 nmol ¥38,000
INH0773 hsa-miR-1257 Inhibitor AGUGAAUGAUGGGUUCUGACC 5 nmol ¥38,000
MIM0774 hsa-miR-1258 Mimic AGUUAGGAUUAGGUCGUGGAA 5 nmol ¥38,000
INH0774 hsa-miR-1258 Inhibitor AGUUAGGAUUAGGUCGUGGAA 5 nmol ¥38,000
MIM0776 hsa-miR-1260a Mimic AUCCCACCUCUGCCACCA 5 nmol ¥38,000
INH0776 hsa-miR-1260a Inhibitor AUCCCACCUCUGCCACCA 5 nmol ¥38,000
MIM0777 hsa-miR-1261 Mimic AUGGAUAAGGCUUUGGCUU 5 nmol ¥38,000
INH0777 hsa-miR-1261 Inhibitor AUGGAUAAGGCUUUGGCUU 5 nmol ¥38,000
MIM0778 hsa-miR-1262 Mimic AUGGGUGAAUUUGUAGAAGGAU 5 nmol ¥38,000
INH0778 hsa-miR-1262 Inhibitor AUGGGUGAAUUUGUAGAAGGAU 5 nmol ¥38,000
MIM0779 hsa-miR-1263 Mimic AUGGUACCCUGGCAUACUGAGU 5 nmol ¥38,000
INH0779 hsa-miR-1263 Inhibitor AUGGUACCCUGGCAUACUGAGU 5 nmol ¥38,000
MIM0780 hsa-miR-1264 Mimic CAAGUCUUAUUUGAGCACCUGUU 5 nmol ¥38,000
INH0780 hsa-miR-1264 Inhibitor CAAGUCUUAUUUGAGCACCUGUU 5 nmol ¥38,000
MIM0781 hsa-miR-1265 Mimic CAGGAUGUGGUCAAGUGUUGUU 5 nmol ¥38,000
INH0781 hsa-miR-1265 Inhibitor CAGGAUGUGGUCAAGUGUUGUU 5 nmol ¥38,000
MIM0782 hsa-miR-1266 Mimic CCUCAGGGCUGUAGAACAGGGCU 5 nmol ¥38,000
INH0782 hsa-miR-1266 Inhibitor CCUCAGGGCUGUAGAACAGGGCU 5 nmol ¥38,000
MIM0783 hsa-miR-1267 Mimic CCUGUUGAAGUGUAAUCCCCA 5 nmol ¥38,000
INH0783 hsa-miR-1267 Inhibitor CCUGUUGAAGUGUAAUCCCCA 5 nmol ¥38,000
MIM0784 hsa-miR-1268a Mimic CGGGCGUGGUGGUGGGGG 5 nmol ¥38,000
INH0784 hsa-miR-1268a Inhibitor CGGGCGUGGUGGUGGGGG 5 nmol ¥38,000
MIM0785 hsa-miR-1269a Mimic CUGGACUGAGCCGUGCUACUGG 5 nmol ¥38,000
INH0785 hsa-miR-1269a Inhibitor CUGGACUGAGCCGUGCUACUGG 5 nmol ¥38,000
MIM0786 hsa-miR-1270 Mimic CUGGAGAUAUGGAAGAGCUGUGU 5 nmol ¥38,000
INH0786 hsa-miR-1270 Inhibitor CUGGAGAUAUGGAAGAGCUGUGU 5 nmol ¥38,000
MIM0787 hsa-miR-1271-5p Mimic CUUGGCACCUAGCAAGCACUCA 5 nmol ¥38,000
INH0787 hsa-miR-1271-5p Inhibitor CUUGGCACCUAGCAAGCACUCA 5 nmol ¥38,000
MIM0788 hsa-miR-1272 Mimic GAUGAUGAUGGCAGCAAAUUCUGAAA 5 nmol ¥38,000
INH0788 hsa-miR-1272 Inhibitor GAUGAUGAUGGCAGCAAAUUCUGAAA 5 nmol ¥38,000
MIM0789 hsa-miR-1273a Mimic GGGCGACAAAGCAAGACUCUUUCUU 5 nmol ¥38,000
INH0789 hsa-miR-1273a Inhibitor GGGCGACAAAGCAAGACUCUUUCUU 5 nmol ¥38,000
MIM0792 hsa-miR-1275 Mimic GUGGGGGAGAGGCUGUC 5 nmol ¥38,000
INH0792 hsa-miR-1275 Inhibitor GUGGGGGAGAGGCUGUC 5 nmol ¥38,000
MIM0793 hsa-miR-1276 Mimic UAAAGAGCCCUGUGGAGACA 5 nmol ¥38,000
INH0793 hsa-miR-1276 Inhibitor UAAAGAGCCCUGUGGAGACA 5 nmol ¥38,000
MIM0794 hsa-miR-1277-3p Mimic UACGUAGAUAUAUAUGUAUUUU 5 nmol ¥38,000
INH0794 hsa-miR-1277-3p Inhibitor UACGUAGAUAUAUAUGUAUUUU 5 nmol ¥38,000
MIM0795 hsa-miR-1278 Mimic UAGUACUGUGCAUAUCAUCUAU 5 nmol ¥38,000
INH0795 hsa-miR-1278 Inhibitor UAGUACUGUGCAUAUCAUCUAU 5 nmol ¥38,000
MIM0796 hsa-miR-1279 Mimic UCAUAUUGCUUCUUUCU 5 nmol ¥38,000
INH0796 hsa-miR-1279 Inhibitor UCAUAUUGCUUCUUUCU 5 nmol ¥38,000
MIM0797 hsa-miR-1280 Mimic UCCCACCGCUGCCACCC 5 nmol ¥38,000
INH0797 hsa-miR-1280 Inhibitor UCCCACCGCUGCCACCC 5 nmol ¥38,000
MIM0798 hsa-miR-1281 Mimic UCGCCUCCUCCUCUCCC 5 nmol ¥38,000
INH0798 hsa-miR-1281 Inhibitor UCGCCUCCUCCUCUCCC 5 nmol ¥38,000
MIM0799 hsa-miR-1282 Mimic UCGUUUGCCUUUUUCUGCUU 5 nmol ¥38,000
INH0799 hsa-miR-1282 Inhibitor UCGUUUGCCUUUUUCUGCUU 5 nmol ¥38,000
MIM0800 hsa-miR-1283 Mimic UCUACAAAGGAAAGCGCUUUCU 5 nmol ¥38,000
INH0800 hsa-miR-1283 Inhibitor UCUACAAAGGAAAGCGCUUUCU 5 nmol ¥38,000
MIM0801 hsa-miR-1284 Mimic UCUAUACAGACCCUGGCUUUUC 5 nmol ¥38,000
INH0801 hsa-miR-1284 Inhibitor UCUAUACAGACCCUGGCUUUUC 5 nmol ¥38,000
MIM0802 hsa-miR-1285-3p Mimic UCUGGGCAACAAAGUGAGACCU 5 nmol ¥38,000
INH0802 hsa-miR-1285-3p Inhibitor UCUGGGCAACAAAGUGAGACCU 5 nmol ¥38,000
MIM0803 hsa-miR-1286 Mimic UGCAGGACCAAGAUGAGCCCU 5 nmol ¥38,000
INH0803 hsa-miR-1286 Inhibitor UGCAGGACCAAGAUGAGCCCU 5 nmol ¥38,000
MIM0804 hsa-miR-1287 Mimic UGCUGGAUCAGUGGUUCGAGUC 5 nmol ¥38,000
INH0804 hsa-miR-1287 Inhibitor UGCUGGAUCAGUGGUUCGAGUC 5 nmol ¥38,000
MIM0805 hsa-miR-1288 Mimic UGGACUGCCCUGAUCUGGAGA 5 nmol ¥38,000
INH0805 hsa-miR-1288 Inhibitor UGGACUGCCCUGAUCUGGAGA 5 nmol ¥38,000
MIM0806 hsa-miR-1289 Mimic UGGAGUCCAGGAAUCUGCAUUUU 5 nmol ¥38,000
INH0806 hsa-miR-1289 Inhibitor UGGAGUCCAGGAAUCUGCAUUUU 5 nmol ¥38,000
MIM0807 hsa-miR-1290 Mimic UGGAUUUUUGGAUCAGGGA 5 nmol ¥38,000
INH0807 hsa-miR-1290 Inhibitor UGGAUUUUUGGAUCAGGGA 5 nmol ¥38,000
MIM0808 hsa-miR-1291 Mimic UGGCCCUGACUGAAGACCAGCAGU 5 nmol ¥38,000
INH0808 hsa-miR-1291 Inhibitor UGGCCCUGACUGAAGACCAGCAGU 5 nmol ¥38,000
MIM0809 hsa-miR-1292 Mimic UGGGAACGGGUUCCGGCAGACGCUG 5 nmol ¥38,000
INH0809 hsa-miR-1292 Inhibitor UGGGAACGGGUUCCGGCAGACGCUG 5 nmol ¥38,000
MIM0810 hsa-miR-1293 Mimic UGGGUGGUCUGGAGAUUUGUGC 5 nmol ¥38,000
INH0810 hsa-miR-1293 Inhibitor UGGGUGGUCUGGAGAUUUGUGC 5 nmol ¥38,000
MIM0811 hsa-miR-1294 Mimic UGUGAGGUUGGCAUUGUUGUCU 5 nmol ¥38,000
INH0811 hsa-miR-1294 Inhibitor UGUGAGGUUGGCAUUGUUGUCU 5 nmol ¥38,000
MIM0812 hsa-miR-1295a Mimic UUAGGCCGCAGAUCUGGGUGA 5 nmol ¥38,000
INH0812 hsa-miR-1295a Inhibitor UUAGGCCGCAGAUCUGGGUGA 5 nmol ¥38,000
MIM0813 hsa-miR-1296 Mimic UUAGGGCCCUGGCUCCAUCUCC 5 nmol ¥38,000
INH0813 hsa-miR-1296 Inhibitor UUAGGGCCCUGGCUCCAUCUCC 5 nmol ¥38,000
MIM0814 hsa-miR-1297 Mimic UUCAAGUAAUUCAGGUG 5 nmol ¥38,000
INH0814 hsa-miR-1297 Inhibitor UUCAAGUAAUUCAGGUG 5 nmol ¥38,000
MIM0815 hsa-miR-1298 Mimic UUCAUUCGGCUGUCCAGAUGUA 5 nmol ¥38,000
INH0815 hsa-miR-1298 Inhibitor UUCAUUCGGCUGUCCAGAUGUA 5 nmol ¥38,000
MIM0816 hsa-miR-1299 Mimic UUCUGGAAUUCUGUGUGAGGGA 5 nmol ¥38,000
INH0816 hsa-miR-1299 Inhibitor UUCUGGAAUUCUGUGUGAGGGA 5 nmol ¥38,000
MIM0818 hsa-miR-1301 Mimic UUGCAGCUGCCUGGGAGUGACUUC 5 nmol ¥38,000
INH0818 hsa-miR-1301 Inhibitor UUGCAGCUGCCUGGGAGUGACUUC 5 nmol ¥38,000
MIM0819 hsa-miR-1302 Mimic UUGGGACAUACUUAUGCUAAA 5 nmol ¥38,000
INH0819 hsa-miR-1302 Inhibitor UUGGGACAUACUUAUGCUAAA 5 nmol ¥38,000
MIM0820 hsa-miR-1303 Mimic UUUAGAGACGGGGUCUUGCUCU 5 nmol ¥38,000
INH0820 hsa-miR-1303 Inhibitor UUUAGAGACGGGGUCUUGCUCU 5 nmol ¥38,000
MIM0821 hsa-miR-1306-3p Mimic ACGUUGGCUCUGGUGGUG 5 nmol ¥38,000
INH0821 hsa-miR-1306-3p Inhibitor ACGUUGGCUCUGGUGGUG 5 nmol ¥38,000
MIM0822 hsa-miR-1307-3p Mimic ACUCGGCGUGGCGUCGGUCGUG 5 nmol ¥38,000
INH0822 hsa-miR-1307-3p Inhibitor ACUCGGCGUGGCGUCGGUCGUG 5 nmol ¥38,000
MIM0824 hsa-miR-1321 Mimic CAGGGAGGUGAAUGUGAU 5 nmol ¥38,000
INH0824 hsa-miR-1321 Inhibitor CAGGGAGGUGAAUGUGAU 5 nmol ¥38,000
MIM0825 hsa-miR-1322 Mimic GAUGAUGCUGCUGAUGCUG 5 nmol ¥38,000
INH0825 hsa-miR-1322 Inhibitor GAUGAUGCUGCUGAUGCUG 5 nmol ¥38,000
MIM0826 hsa-miR-1323 Mimic UCAAAACUGAGGGGCAUUUUCU 5 nmol ¥38,000
INH0826 hsa-miR-1323 Inhibitor UCAAAACUGAGGGGCAUUUUCU 5 nmol ¥38,000
MIM0827 hsa-miR-1324 Mimic CCAGACAGAAUUCUAUGCACUUUC 5 nmol ¥38,000
INH0827 hsa-miR-1324 Inhibitor CCAGACAGAAUUCUAUGCACUUUC 5 nmol ¥38,000
MIM0828 hsa-miR-1468 Mimic CUCCGUUUGCCUGUUUCGCUG 5 nmol ¥38,000
INH0828 hsa-miR-1468 Inhibitor CUCCGUUUGCCUGUUUCGCUG 5 nmol ¥38,000
MIM0829 hsa-miR-1469 Mimic CUCGGCGCGGGGCGCGGGCUCC 5 nmol ¥38,000
INH0829 hsa-miR-1469 Inhibitor CUCGGCGCGGGGCGCGGGCUCC 5 nmol ¥38,000
MIM0830 hsa-miR-1470 Mimic GCCCUCCGCCCGUGCACCCCG 5 nmol ¥38,000
INH0830 hsa-miR-1470 Inhibitor GCCCUCCGCCCGUGCACCCCG 5 nmol ¥38,000
MIM0831 hsa-miR-1471 Mimic GCCCGCGUGUGGAGCCAGGUGU 5 nmol ¥38,000
INH0831 hsa-miR-1471 Inhibitor GCCCGCGUGUGGAGCCAGGUGU 5 nmol ¥38,000
MIM0832 hsa-miR-1537 Mimic AAAACCGUCUAGUUACAGUUGU 5 nmol ¥38,000
INH0832 hsa-miR-1537 Inhibitor AAAACCGUCUAGUUACAGUUGU 5 nmol ¥38,000
MIM0833 hsa-miR-1538 Mimic CGGCCCGGGCUGCUGCUGUUCCU 5 nmol ¥38,000
INH0833 hsa-miR-1538 Inhibitor CGGCCCGGGCUGCUGCUGUUCCU 5 nmol ¥38,000
MIM0834 hsa-miR-1539 Mimic UCCUGCGCGUCCCAGAUGCCC 5 nmol ¥38,000
INH0834 hsa-miR-1539 Inhibitor UCCUGCGCGUCCCAGAUGCCC 5 nmol ¥38,000
MIM0835 hsa-miR-1825 Mimic UCCAGUGCCCUCCUCUCC 5 nmol ¥38,000
INH0835 hsa-miR-1825 Inhibitor UCCAGUGCCCUCCUCUCC 5 nmol ¥38,000
MIM0837 hsa-miR-1827 Mimic UGAGGCAGUAGAUUGAAU 5 nmol ¥38,000
INH0837 hsa-miR-1827 Inhibitor UGAGGCAGUAGAUUGAAU 5 nmol ¥38,000
MIM0838 hsa-miR-1908 Mimic CGGCGGGGACGGCGAUUGGUC 5 nmol ¥38,000
INH0838 hsa-miR-1908 Inhibitor CGGCGGGGACGGCGAUUGGUC 5 nmol ¥38,000
MIM0839 hsa-miR-1909-3p Mimic CGCAGGGGCCGGGUGCUCACCG 5 nmol ¥38,000
INH0839 hsa-miR-1909-3p Inhibitor CGCAGGGGCCGGGUGCUCACCG 5 nmol ¥38,000
MIM0840 hsa-miR-1909-5p Mimic UGAGUGCCGGUGCCUGCCCUG 5 nmol ¥38,000
INH0840 hsa-miR-1909-5p Inhibitor UGAGUGCCGGUGCCUGCCCUG 5 nmol ¥38,000
MIM0841 hsa-miR-1910 Mimic CCAGUCCUGUGCCUGCCGCCU 5 nmol ¥38,000
INH0841 hsa-miR-1910 Inhibitor CCAGUCCUGUGCCUGCCGCCU 5 nmol ¥38,000
MIM0842 hsa-miR-1911-3p Mimic CACCAGGCAUUGUGGUCUCC 5 nmol ¥38,000
INH0842 hsa-miR-1911-3p Inhibitor CACCAGGCAUUGUGGUCUCC 5 nmol ¥38,000
MIM0843 hsa-miR-1911-5p Mimic UGAGUACCGCCAUGUCUGUUGGG 5 nmol ¥38,000
INH0843 hsa-miR-1911-5p Inhibitor UGAGUACCGCCAUGUCUGUUGGG 5 nmol ¥38,000
MIM0844 hsa-miR-1912 Mimic UACCCAGAGCAUGCAGUGUGAA 5 nmol ¥38,000
INH0844 hsa-miR-1912 Inhibitor UACCCAGAGCAUGCAGUGUGAA 5 nmol ¥38,000
MIM0845 hsa-miR-1913 Mimic UCUGCCCCCUCCGCUGCUGCCA 5 nmol ¥38,000
INH0845 hsa-miR-1913 Inhibitor UCUGCCCCCUCCGCUGCUGCCA 5 nmol ¥38,000
MIM0847 hsa-miR-1914-3p Mimic GGAGGGGUCCCGCACUGGGAGG 5 nmol ¥38,000
INH0847 hsa-miR-1914-3p Inhibitor GGAGGGGUCCCGCACUGGGAGG 5 nmol ¥38,000
MIM0846 hsa-miR-1914-5p Mimic CCCUGUGCCCGGCCCACUUCUG 5 nmol ¥38,000
INH0846 hsa-miR-1914-5p Inhibitor CCCUGUGCCCGGCCCACUUCUG 5 nmol ¥38,000
MIM0849 hsa-miR-1915-3p Mimic CCCCAGGGCGACGCGGCGGG 5 nmol ¥38,000
INH0849 hsa-miR-1915-3p Inhibitor CCCCAGGGCGACGCGGCGGG 5 nmol ¥38,000
MIM0848 hsa-miR-1915-5p Mimic ACCUUGCCUUGCUGCCCGGGCC 5 nmol ¥38,000
INH0848 hsa-miR-1915-5p Inhibitor ACCUUGCCUUGCUGCCCGGGCC 5 nmol ¥38,000
MIM0850 hsa-miR-1972 Mimic UCAGGCCAGGCACAGUGGCUCA 5 nmol ¥38,000
INH0850 hsa-miR-1972 Inhibitor UCAGGCCAGGCACAGUGGCUCA 5 nmol ¥38,000
MIM0851 hsa-miR-1973 Mimic ACCGUGCAAAGGUAGCAUA 5 nmol ¥38,000
INH0851 hsa-miR-1973 Inhibitor ACCGUGCAAAGGUAGCAUA 5 nmol ¥38,000
MIM0854 hsa-miR-1976 Mimic CCUCCUGCCCUCCUUGCUGU 5 nmol ¥38,000
INH0854 hsa-miR-1976 Inhibitor CCUCCUGCCCUCCUUGCUGU 5 nmol ¥38,000
MIM0858 hsa-miR-2052 Mimic UGUUUUGAUAACAGUAAUGU 5 nmol ¥38,000
INH0858 hsa-miR-2052 Inhibitor UGUUUUGAUAACAGUAAUGU 5 nmol ¥38,000
MIM0859 hsa-miR-2053 Mimic GUGUUAAUUAAACCUCUAUUUAC 5 nmol ¥38,000
INH0859 hsa-miR-2053 Inhibitor GUGUUAAUUAAACCUCUAUUUAC 5 nmol ¥38,000
MIM0860 hsa-miR-2054 Mimic CUGUAAUAUAAAUUUAAUUUAUU 5 nmol ¥38,000
INH0860 hsa-miR-2054 Inhibitor CUGUAAUAUAAAUUUAAUUUAUU 5 nmol ¥38,000
MIM0861 hsa-miR-2110 Mimic UUGGGGAAACGGCCGCUGAGUG 5 nmol ¥38,000
INH0861 hsa-miR-2110 Inhibitor UUGGGGAAACGGCCGCUGAGUG 5 nmol ¥38,000
MIM0862 hsa-miR-2113 Mimic AUUUGUGCUUGGCUCUGUCAC 5 nmol ¥38,000
INH0862 hsa-miR-2113 Inhibitor AUUUGUGCUUGGCUCUGUCAC 5 nmol ¥38,000