Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

let-7

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0003 hsa-let-7a-2-3p Mimic CUGUACAGCCUCCUAGCUUUCC 5 nmol ¥38,000
INH0003 hsa-let-7a-2-3p Inhibitor CUGUACAGCCUCCUAGCUUUCC 5 nmol ¥38,000
MIM0002 hsa-let-7a-3p Mimic CUAUACAAUCUACUGUCUUUC 5 nmol ¥38,000
INH0002 hsa-let-7a-3p Inhibitor CUAUACAAUCUACUGUCUUUC 5 nmol ¥38,000
MIM0001 hsa-let-7a-5p Mimic UGAGGUAGUAGGUUGUAUAGUU 5 nmol ¥38,000
INH0001 hsa-let-7a-5p Inhibitor UGAGGUAGUAGGUUGUAUAGUU 5 nmol ¥38,000
MIM0005 hsa-let-7b-3p Mimic CUAUACAACCUACUGCCUUCCC 5 nmol ¥38,000
INH0005 hsa-let-7b-3p Inhibitor CUAUACAACCUACUGCCUUCCC 5 nmol ¥38,000
MIM0004 hsa-let-7b-5p Mimic UGAGGUAGUAGGUUGUGUGGUU 5 nmol ¥38,000
INH0004 hsa-let-7b-5p Inhibitor UGAGGUAGUAGGUUGUGUGGUU 5 nmol ¥38,000
MIM0006 hsa-let-7c Mimic UGAGGUAGUAGGUUGUAUGGUU 5 nmol ¥38,000
INH0006 hsa-let-7c Inhibitor UGAGGUAGUAGGUUGUAUGGUU 5 nmol ¥38,000
MIM0009 hsa-let-7d-3p Mimic CUAUACGACCUGCUGCCUUUCU 5 nmol ¥38,000
INH0009 hsa-let-7d-3p Inhibitor CUAUACGACCUGCUGCCUUUCU 5 nmol ¥38,000
MIM0008 hsa-let-7d-5p Mimic AGAGGUAGUAGGUUGCAUAGUU 5 nmol ¥38,000
INH0008 hsa-let-7d-5p Inhibitor AGAGGUAGUAGGUUGCAUAGUU 5 nmol ¥38,000
MIM0011 hsa-let-7e-3p Mimic CUAUACGGCCUCCUAGCUUUCC 5 nmol ¥38,000
INH0011 hsa-let-7e-3p Inhibitor CUAUACGGCCUCCUAGCUUUCC 5 nmol ¥38,000
MIM0010 hsa-let-7e-5p Mimic UGAGGUAGGAGGUUGUAUAGUU 5 nmol ¥38,000
INH0010 hsa-let-7e-5p Inhibitor UGAGGUAGGAGGUUGUAUAGUU 5 nmol ¥38,000
MIM0013 hsa-let-7f-1-3p Mimic CUAUACAAUCUAUUGCCUUCCC 5 nmol ¥38,000
INH0013 hsa-let-7f-1-3p Inhibitor CUAUACAAUCUAUUGCCUUCCC 5 nmol ¥38,000
MIM0014 hsa-let-7f-2-3p Mimic CUAUACAGUCUACUGUCUUUCC 5 nmol ¥38,000
INH0014 hsa-let-7f-2-3p Inhibitor CUAUACAGUCUACUGUCUUUCC 5 nmol ¥38,000
MIM0012 hsa-let-7f-5p Mimic UGAGGUAGUAGAUUGUAUAGUU 5 nmol ¥38,000
INH0012 hsa-let-7f-5p Inhibitor UGAGGUAGUAGAUUGUAUAGUU 5 nmol ¥38,000
MIM0016 hsa-let-7g-3p Mimic CUGUACAGGCCACUGCCUUGC 5 nmol ¥38,000
INH0016 hsa-let-7g-3p Inhibitor CUGUACAGGCCACUGCCUUGC 5 nmol ¥38,000
MIM0015 hsa-let-7g-5p Mimic UGAGGUAGUAGUUUGUACAGUU 5 nmol ¥38,000
INH0015 hsa-let-7g-5p Inhibitor UGAGGUAGUAGUUUGUACAGUU 5 nmol ¥38,000
MIM0018 hsa-let-7i-3p Mimic CUGCGCAAGCUACUGCCUUGCU 5 nmol ¥38,000
INH0018 hsa-let-7i-3p Inhibitor CUGCGCAAGCUACUGCCUUGCU 5 nmol ¥38,000
MIM0017 hsa-let-7i-5p Mimic UGAGGUAGUAGUUUGUGCUGUU 5 nmol ¥38,000
INH0017 hsa-let-7i-5p Inhibitor UGAGGUAGUAGUUUGUGCUGUU 5 nmol ¥38,000