mIR-100...mIR-199

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0122hsa-miR-100-3p MimicCAAGCUUGUAUCUAUAGGUAUG5 nmol¥38,000
INH0122hsa-miR-100-3p InhibitorCAAGCUUGUAUCUAUAGGUAUG5 nmol¥38,000
MIM0121hsa-miR-100-5p MimicAACCCGUAGAUCCGAACUUGUG5 nmol¥38,000
INH0121hsa-miR-100-5p InhibitorAACCCGUAGAUCCGAACUUGUG5 nmol¥38,000
MIM0124hsa-miR-101-3p MimicUACAGUACUGUGAUAACUGAA5 nmol¥38,000
INH0124hsa-miR-101-3p InhibitorUACAGUACUGUGAUAACUGAA5 nmol¥38,000
MIM0123hsa-miR-101-5p MimicCAGUUAUCACAGUGCUGAUGCU5 nmol¥38,000
INH0123hsa-miR-101-5p InhibitorCAGUUAUCACAGUGCUGAUGCU5 nmol¥38,000
MIM0128hsa-miR-105-3p MimicACGGAUGUUUGAGCAUGUGCUA5 nmol¥38,000
INH0128hsa-miR-105-3p InhibitorACGGAUGUUUGAGCAUGUGCUA5 nmol¥38,000
MIM0129hsa-miR-105-5p MimicUCAAAUGCUCAGACUCCUGUGGU5 nmol¥38,000
INH0129hsa-miR-105-5p InhibitorUCAAAUGCUCAGACUCCUGUGGU5 nmol¥38,000
MIM0132hsa-miR-106a-3p MimicCUGCAAUGUAAGCACUUCUUAC5 nmol¥38,000
INH0132hsa-miR-106a-3p InhibitorCUGCAAUGUAAGCACUUCUUAC5 nmol¥38,000
MIM0130hsa-miR-106a-5p MimicAAAAGUGCUUACAGUGCAGGUAG5 nmol¥38,000
INH0130hsa-miR-106a-5p InhibitorAAAAGUGCUUACAGUGCAGGUAG5 nmol¥38,000
MIM0131hsa-miR-106b-3p MimicCCGCACUGUGGGUACUUGCUGC5 nmol¥38,000
INH0131hsa-miR-106b-3p InhibitorCCGCACUGUGGGUACUUGCUGC5 nmol¥38,000
MIM0133hsa-miR-106b-5p MimicUAAAGUGCUGACAGUGCAGAU5 nmol¥38,000
INH0133hsa-miR-106b-5p InhibitorUAAAGUGCUGACAGUGCAGAU5 nmol¥38,000
MIM0134hsa-miR-107 MimicAGCAGCAUUGUACAGGGCUAUCA5 nmol¥38,000
INH0134hsa-miR-107 InhibitorAGCAGCAUUGUACAGGGCUAUCA5 nmol¥38,000
MIM0135hsa-miR-122-3p MimicAACGCCAUUAUCACACUAAAUA5 nmol¥38,000
INH0135hsa-miR-122-3p InhibitorAACGCCAUUAUCACACUAAAUA5 nmol¥38,000
MIM0136hsa-miR-122-5p MimicUGGAGUGUGACAAUGGUGUUUG5 nmol¥38,000
INH0136hsa-miR-122-5p InhibitorUGGAGUGUGACAAUGGUGUUUG5 nmol¥38,000
MIM0138hsa-miR-124-3p MimicUAAGGCACGCGGUGAAUGCC5 nmol¥38,000
INH0138hsa-miR-124-3p InhibitorUAAGGCACGCGGUGAAUGCC5 nmol¥38,000
MIM0137hsa-miR-124-5p MimicCGUGUUCACAGCGGACCUUGAU5 nmol¥38,000
INH0137hsa-miR-124-5p InhibitorCGUGUUCACAGCGGACCUUGAU5 nmol¥38,000
MIM0139hsa-miR-125a-3p MimicACAGGUGAGGUUCUUGGGAGCC5 nmol¥38,000
INH0139hsa-miR-125a-3p InhibitorACAGGUGAGGUUCUUGGGAGCC5 nmol¥38,000
MIM0143hsa-miR-125a-5p MimicUCCCUGAGACCCUUUAACCUGUGA5 nmol¥38,000
INH0143hsa-miR-125a-5p InhibitorUCCCUGAGACCCUUUAACCUGUGA5 nmol¥38,000
MIM0140hsa-miR-125b-1-3p MimicACGGGUUAGGCUCUUGGGAGCU5 nmol¥38,000
INH0140hsa-miR-125b-1-3p InhibitorACGGGUUAGGCUCUUGGGAGCU5 nmol¥38,000
MIM0141hsa-miR-125b-2-3p MimicUCACAAGUCAGGCUCUUGGGAC5 nmol¥38,000
INH0141hsa-miR-125b-2-3p InhibitorUCACAAGUCAGGCUCUUGGGAC5 nmol¥38,000
MIM0142hsa-miR-125b-5p MimicUCCCUGAGACCCUAACUUGUGA5 nmol¥38,000
INH0142hsa-miR-125b-5p InhibitorUCCCUGAGACCCUAACUUGUGA5 nmol¥38,000
MIM0145hsa-miR-126-3p MimicUCGUACCGUGAGUAAUAAUGCG5 nmol¥38,000
INH0145hsa-miR-126-3p InhibitorUCGUACCGUGAGUAAUAAUGCG5 nmol¥38,000
MIM0144hsa-miR-126-5p MimicCAUUAUUACUUUUGGUACGCG5 nmol¥38,000
INH0144hsa-miR-126-5p InhibitorCAUUAUUACUUUUGGUACGCG5 nmol¥38,000
MIM0147hsa-miR-127-3p MimicUCGGAUCCGUCUGAGCUUGGCU5 nmol¥38,000
INH0147hsa-miR-127-3p InhibitorUCGGAUCCGUCUGAGCUUGGCU5 nmol¥38,000
MIM0146hsa-miR-127-5p MimicCUGAAGCUCAGAGGGCUCUGAU5 nmol¥38,000
INH0146hsa-miR-127-5p InhibitorCUGAAGCUCAGAGGGCUCUGAU5 nmol¥38,000
MIM0148hsa-miR-128 MimicUCACAGUGAACCGGUCUCUUU5 nmol¥38,000
INH0148hsa-miR-128 InhibitorUCACAGUGAACCGGUCUCUUU5 nmol¥38,000
MIM0150hsa-miR-129-1-3p MimicAAGCCCUUACCCCAAAAAGUAU5 nmol¥38,000
INH0150hsa-miR-129-1-3p InhibitorAAGCCCUUACCCCAAAAAGUAU5 nmol¥38,000
MIM0149hsa-miR-129-2-3p MimicAAGCCCUUACCCCAAAAAGCAU5 nmol¥38,000
INH0149hsa-miR-129-2-3p InhibitorAAGCCCUUACCCCAAAAAGCAU5 nmol¥38,000
MIM0151hsa-miR-129-5p MimicCUUUUUGCGGUCUGGGCUUGC5 nmol¥38,000
INH0151hsa-miR-129-5p InhibitorCUUUUUGCGGUCUGGGCUUGC5 nmol¥38,000
MIM0154hsa-miR-130a-3p MimicCAGUGCAAUGUUAAAAGGGCAU5 nmol¥38,000
INH0154hsa-miR-130a-3p InhibitorCAGUGCAAUGUUAAAAGGGCAU5 nmol¥38,000
MIM0155hsa-miR-130a-5p MimicUUCACAUUGUGCUACUGUCUGC5 nmol¥38,000
INH0155hsa-miR-130a-5p InhibitorUUCACAUUGUGCUACUGUCUGC5 nmol¥38,000
MIM0153hsa-miR-130b-3p MimicCAGUGCAAUGAUGAAAGGGCAU5 nmol¥38,000
INH0153hsa-miR-130b-3p InhibitorCAGUGCAAUGAUGAAAGGGCAU5 nmol¥38,000
MIM0152hsa-miR-130b-5p MimicACUCUUUCCCUGUUGCACUAC5 nmol¥38,000
INH0152hsa-miR-130b-5p InhibitorACUCUUUCCCUGUUGCACUAC5 nmol¥38,000
MIM0157hsa-miR-132-3p MimicUAACAGUCUACAGCCAUGGUCG5 nmol¥38,000
INH0157hsa-miR-132-3p InhibitorUAACAGUCUACAGCCAUGGUCG5 nmol¥38,000
MIM0156hsa-miR-132-5p MimicACCGUGGCUUUCGAUUGUUACU5 nmol¥38,000
INH0156hsa-miR-132-5p InhibitorACCGUGGCUUUCGAUUGUUACU5 nmol¥38,000
MIM0863hsa-miR-133a-3p MimicUUUGGUCCCCUUCAACCAGCUG5 nmol¥38,000
INH0863hsa-miR-133a-3p InhibitorUUUGGUCCCCUUCAACCAGCUG5 nmol¥38,000
MIM0864hsa-miR-133a-5p MimicAGCUGGUAAAAUGGAACCAAAU5 nmol¥38,000
INH0864hsa-miR-133a-5p InhibitorAGCUGGUAAAAUGGAACCAAAU5 nmol¥38,000
MIM0158hsa-miR-134 MimicUGUGACUGGUUGACCAGAGGGG5 nmol¥38,000
INH0158hsa-miR-134 InhibitorUGUGACUGGUUGACCAGAGGGG5 nmol¥38,000
MIM0160hsa-miR-135a-3p MimicUAUAGGGAUUGGAGCCGUGGCG5 nmol¥38,000
INH0160hsa-miR-135a-3p InhibitorUAUAGGGAUUGGAGCCGUGGCG5 nmol¥38,000
MIM0162hsa-miR-135a-5p MimicUAUGGCUUUUUAUUCCUAUGUGA5 nmol¥38,000
INH0162hsa-miR-135a-5p InhibitorUAUGGCUUUUUAUUCCUAUGUGA5 nmol¥38,000
MIM0159hsa-miR-135b-3p MimicAUGUAGGGCUAAAAGCCAUGGG5 nmol¥38,000
INH0159hsa-miR-135b-3p InhibitorAUGUAGGGCUAAAAGCCAUGGG5 nmol¥38,000
MIM0161hsa-miR-135b-5p MimicUAUGGCUUUUCAUUCCUAUGUGA5 nmol¥38,000
INH0161hsa-miR-135b-5p InhibitorUAUGGCUUUUCAUUCCUAUGUGA5 nmol¥38,000
MIM0164hsa-miR-136-3p MimicCAUCAUCGUCUCAAAUGAGUCU5 nmol¥38,000
INH0164hsa-miR-136-3p InhibitorCAUCAUCGUCUCAAAUGAGUCU5 nmol¥38,000
MIM0163hsa-miR-136-5p MimicACUCCAUUUGUUUUGAUGAUGGA5 nmol¥38,000
INH0163hsa-miR-136-5p InhibitorACUCCAUUUGUUUUGAUGAUGGA5 nmol¥38,000
MIM0165hsa-miR-137 MimicUUAUUGCUUAAGAAUACGCGUAG5 nmol¥38,000
INH0165hsa-miR-137 InhibitorUUAUUGCUUAAGAAUACGCGUAG5 nmol¥38,000
MIM0167hsa-miR-138-1-3p MimicGCUACUUCACAACACCAGGGCC5 nmol¥38,000
INH0167hsa-miR-138-1-3p InhibitorGCUACUUCACAACACCAGGGCC5 nmol¥38,000
MIM0168hsa-miR-138-2-3p MimicGCUAUUUCACGACACCAGGGUU5 nmol¥38,000
INH0168hsa-miR-138-2-3p InhibitorGCUAUUUCACGACACCAGGGUU5 nmol¥38,000
MIM0166hsa-miR-138-5p MimicAGCUGGUGUUGUGAAUCAGGCCG5 nmol¥38,000
INH0166hsa-miR-138-5p InhibitorAGCUGGUGUUGUGAAUCAGGCCG5 nmol¥38,000
MIM0169hsa-miR-139-3p MimicGGAGACGCGGCCCUGUUGGAGU5 nmol¥38,000
INH0169hsa-miR-139-3p InhibitorGGAGACGCGGCCCUGUUGGAGU5 nmol¥38,000
MIM0170hsa-miR-139-5p MimicUCUACAGUGCACGUGUCUCCAG5 nmol¥38,000
INH0170hsa-miR-139-5p InhibitorUCUACAGUGCACGUGUCUCCAG5 nmol¥38,000
MIM0172hsa-miR-140-3p MimicUACCACAGGGUAGAACCACGG5 nmol¥38,000
INH0172hsa-miR-140-3p InhibitorUACCACAGGGUAGAACCACGG5 nmol¥38,000
MIM0171hsa-miR-140-5p MimicCAGUGGUUUUACCCUAUGGUAG5 nmol¥38,000
INH0171hsa-miR-140-5p InhibitorCAGUGGUUUUACCCUAUGGUAG5 nmol¥38,000
MIM0174hsa-miR-141-3p MimicUAACACUGUCUGGUAAAGAUGG5 nmol¥38,000
INH0174hsa-miR-141-3p InhibitorUAACACUGUCUGGUAAAGAUGG5 nmol¥38,000
MIM0173hsa-miR-141-5p MimicCAUCUUCCAGUACAGUGUUGGA5 nmol¥38,000
INH0173hsa-miR-141-5p InhibitorCAUCUUCCAGUACAGUGUUGGA5 nmol¥38,000
MIM0176hsa-miR-142-3p MimicUGUAGUGUUUCCUACUUUAUGGA5 nmol¥38,000
INH0176hsa-miR-142-3p InhibitorUGUAGUGUUUCCUACUUUAUGGA5 nmol¥38,000
MIM0175hsa-miR-142-5p MimicCAUAAAGUAGAAAGCACUACU5 nmol¥38,000
INH0175hsa-miR-142-5p InhibitorCAUAAAGUAGAAAGCACUACU5 nmol¥38,000
MIM0178hsa-miR-143-3p MimicUGAGAUGAAGCACUGUAGCUC5 nmol¥38,000
INH0178hsa-miR-143-3p InhibitorUGAGAUGAAGCACUGUAGCUC5 nmol¥38,000
MIM0177hsa-miR-143-5p MimicGGUGCAGUGCUGCAUCUCUGGU5 nmol¥38,000
INH0177hsa-miR-143-5p InhibitorGGUGCAGUGCUGCAUCUCUGGU5 nmol¥38,000
MIM0180hsa-miR-144-3p MimicUACAGUAUAGAUGAUGUACU5 nmol¥38,000
INH0180hsa-miR-144-3p InhibitorUACAGUAUAGAUGAUGUACU5 nmol¥38,000
MIM0179hsa-miR-144-5p MimicGGAUAUCAUCAUAUACUGUAAG5 nmol¥38,000
INH0179hsa-miR-144-5p InhibitorGGAUAUCAUCAUAUACUGUAAG5 nmol¥38,000
MIM0181hsa-miR-145-3p MimicGGAUUCCUGGAAAUACUGUUCU5 nmol¥38,000
INH0181hsa-miR-145-3p InhibitorGGAUUCCUGGAAAUACUGUUCU5 nmol¥38,000
MIM0182hsa-miR-145-5p MimicGUCCAGUUUUCCCAGGAAUCCCU5 nmol¥38,000
INH0182hsa-miR-145-5p InhibitorGUCCAGUUUUCCCAGGAAUCCCU5 nmol¥38,000
MIM0183hsa-miR-146a-3p MimicCCUCUGAAAUUCAGUUCUUCAG5 nmol¥38,000
INH0183hsa-miR-146a-3p InhibitorCCUCUGAAAUUCAGUUCUUCAG5 nmol¥38,000
MIM0185hsa-miR-146a-5p MimicUGAGAACUGAAUUCCAUGGGUU5 nmol¥38,000
INH0185hsa-miR-146a-5p InhibitorUGAGAACUGAAUUCCAUGGGUU5 nmol¥38,000
MIM0186hsa-miR-146b-3p MimicUGCCCUGUGGACUCAGUUCUGG5 nmol¥38,000
INH0186hsa-miR-146b-3p InhibitorUGCCCUGUGGACUCAGUUCUGG5 nmol¥38,000
MIM0184hsa-miR-146b-5p MimicUGAGAACUGAAUUCCAUAGGCU5 nmol¥38,000
INH0184hsa-miR-146b-5p InhibitorUGAGAACUGAAUUCCAUAGGCU5 nmol¥38,000
MIM0188hsa-miR-147a MimicGUGUGUGGAAAUGCUUCUGC5 nmol¥38,000
INH0188hsa-miR-147a InhibitorGUGUGUGGAAAUGCUUCUGC5 nmol¥38,000
MIM0187hsa-miR-147b MimicGUGUGCGGAAAUGCUUCUGCUA5 nmol¥38,000
INH0187hsa-miR-147b InhibitorGUGUGCGGAAAUGCUUCUGCUA5 nmol¥38,000
MIM0191hsa-miR-148a-3p MimicUCAGUGCACUACAGAACUUUGU5 nmol¥38,000
INH0191hsa-miR-148a-3p InhibitorUCAGUGCACUACAGAACUUUGU5 nmol¥38,000
MIM0189hsa-miR-148a-5p MimicAAAGUUCUGAGACACUCCGACU5 nmol¥38,000
INH0189hsa-miR-148a-5p InhibitorAAAGUUCUGAGACACUCCGACU5 nmol¥38,000
MIM0192hsa-miR-148b-3p MimicUCAGUGCAUCACAGAACUUUGU5 nmol¥38,000
INH0192hsa-miR-148b-3p InhibitorUCAGUGCAUCACAGAACUUUGU5 nmol¥38,000
MIM0190hsa-miR-148b-5p MimicAAGUUCUGUUAUACACUCAGGC5 nmol¥38,000
INH0190hsa-miR-148b-5p InhibitorAAGUUCUGUUAUACACUCAGGC5 nmol¥38,000
MIM0193hsa-miR-149-3p MimicAGGGAGGGACGGGGGCUGUGC5 nmol¥38,000
INH0193hsa-miR-149-3p InhibitorAGGGAGGGACGGGGGCUGUGC5 nmol¥38,000
MIM0194hsa-miR-149-5p MimicUCUGGCUCCGUGUCUUCACUCCC5 nmol¥38,000
INH0194hsa-miR-149-5p InhibitorUCUGGCUCCGUGUCUUCACUCCC5 nmol¥38,000
MIM0195hsa-miR-150-3p MimicCUGGUACAGGCCUGGGGGACAG5 nmol¥38,000
INH0195hsa-miR-150-3p InhibitorCUGGUACAGGCCUGGGGGACAG5 nmol¥38,000
MIM0196hsa-miR-150-5p MimicUCUCCCAACCCUUGUACCAGUG5 nmol¥38,000
INH0196hsa-miR-150-5p InhibitorUCUCCCAACCCUUGUACCAGUG5 nmol¥38,000
MIM0197hsa-miR-151a-3p MimicCUAGACUGAAGCUCCUUGAGG5 nmol¥38,000
INH0197hsa-miR-151a-3p InhibitorCUAGACUGAAGCUCCUUGAGG5 nmol¥38,000
MIM0198hsa-miR-151a-5p MimicUCGAGGAGCUCACAGUCUAGU5 nmol¥38,000
INH0198hsa-miR-151a-5p InhibitorUCGAGGAGCUCACAGUCUAGU5 nmol¥38,000
MIM0199hsa-miR-152 MimicUCAGUGCAUGACAGAACUUGG5 nmol¥38,000
INH0199hsa-miR-152 InhibitorUCAGUGCAUGACAGAACUUGG5 nmol¥38,000
MIM0200hsa-miR-153 MimicUUGCAUAGUCACAAAAGUGAUC5 nmol¥38,000
INH0200hsa-miR-153 InhibitorUUGCAUAGUCACAAAAGUGAUC5 nmol¥38,000
MIM0201hsa-miR-154-3p MimicAAUCAUACACGGUUGACCUAUU5 nmol¥38,000
INH0201hsa-miR-154-3p InhibitorAAUCAUACACGGUUGACCUAUU5 nmol¥38,000
MIM0202hsa-miR-154-5p MimicUAGGUUAUCCGUGUUGCCUUCG5 nmol¥38,000
INH0202hsa-miR-154-5p InhibitorUAGGUUAUCCGUGUUGCCUUCG5 nmol¥38,000
MIM0203hsa-miR-155-3p MimicCUCCUACAUAUUAGCAUUAACA5 nmol¥38,000
INH0203hsa-miR-155-3p InhibitorCUCCUACAUAUUAGCAUUAACA5 nmol¥38,000
MIM0204hsa-miR-155-5p MimicUUAAUGCUAAUCGUGAUAGGGGU5 nmol¥38,000
INH0204hsa-miR-155-5p InhibitorUUAAUGCUAAUCGUGAUAGGGGU5 nmol¥38,000
MIM0210hsa-miR-181a-2-3p MimicACCACUGACCGUUGACUGUACC5 nmol¥38,000
INH0210hsa-miR-181a-2-3p InhibitorACCACUGACCGUUGACUGUACC5 nmol¥38,000
MIM0211hsa-miR-181a-3p MimicACCAUCGACCGUUGAUUGUACC5 nmol¥38,000
INH0211hsa-miR-181a-3p InhibitorACCAUCGACCGUUGAUUGUACC5 nmol¥38,000
MIM0206hsa-miR-181a-5p MimicAACAUUCAACGCUGUCGGUGAGU5 nmol¥38,000
INH0206hsa-miR-181a-5p InhibitorAACAUUCAACGCUGUCGGUGAGU5 nmol¥38,000
MIM0207hsa-miR-181b-5p MimicAACAUUCAUUGCUGUCGGUGGGU5 nmol¥38,000
INH0207hsa-miR-181b-5p InhibitorAACAUUCAUUGCUGUCGGUGGGU5 nmol¥38,000
MIM0209hsa-miR-181c-3p MimicAACCAUCGACCGUUGAGUGGAC5 nmol¥38,000
INH0209hsa-miR-181c-3p InhibitorAACCAUCGACCGUUGAGUGGAC5 nmol¥38,000
MIM0205hsa-miR-181c-5p MimicAACAUUCAACCUGUCGGUGAGU5 nmol¥38,000
INH0205hsa-miR-181c-5p InhibitorAACAUUCAACCUGUCGGUGAGU5 nmol¥38,000
MIM0208hsa-miR-181d MimicAACAUUCAUUGUUGUCGGUGGGU5 nmol¥38,000
INH0208hsa-miR-181d InhibitorAACAUUCAUUGUUGUCGGUGGGU5 nmol¥38,000
MIM0212hsa-miR-182-3p MimicUGGUUCUAGACUUGCCAACUA5 nmol¥38,000
INH0212hsa-miR-182-3p InhibitorUGGUUCUAGACUUGCCAACUA5 nmol¥38,000
MIM0866hsa-miR-182-5p MimicUUUGGCAAUGGUAGAACUCACACU5 nmol¥38,000
INH0866hsa-miR-182-5p InhibitorUUUGGCAAUGGUAGAACUCACACU5 nmol¥38,000
MIM0213hsa-miR-183-3p MimicGUGAAUUACCGAAGGGCCAUAA5 nmol¥38,000
INH0213hsa-miR-183-3p InhibitorGUGAAUUACCGAAGGGCCAUAA5 nmol¥38,000
MIM0214hsa-miR-183-5p MimicUAUGGCACUGGUAGAAUUCACU5 nmol¥38,000
INH0214hsa-miR-183-5p InhibitorUAUGGCACUGGUAGAAUUCACU5 nmol¥38,000
MIM0215hsa-miR-184 MimicUGGACGGAGAACUGAUAAGGGU5 nmol¥38,000
INH0215hsa-miR-184 InhibitorUGGACGGAGAACUGAUAAGGGU5 nmol¥38,000
MIM0216hsa-miR-185-3p MimicAGGGGCUGGCUUUCCUCUGGUC5 nmol¥38,000
INH0216hsa-miR-185-3p InhibitorAGGGGCUGGCUUUCCUCUGGUC5 nmol¥38,000
MIM0217hsa-miR-185-5p MimicUGGAGAGAAAGGCAGUUCCUGA5 nmol¥38,000
INH0217hsa-miR-185-5p InhibitorUGGAGAGAAAGGCAGUUCCUGA5 nmol¥38,000
MIM0219hsa-miR-186-3p MimicGCCCAAAGGUGAAUUUUUUGGG5 nmol¥38,000
INH0219hsa-miR-186-3p InhibitorGCCCAAAGGUGAAUUUUUUGGG5 nmol¥38,000
MIM0218hsa-miR-186-5p MimicCAAAGAAUUCUCCUUUUGGGCU5 nmol¥38,000
INH0218hsa-miR-186-5p InhibitorCAAAGAAUUCUCCUUUUGGGCU5 nmol¥38,000
MIM0221hsa-miR-187-3p MimicUCGUGUCUUGUGUUGCAGCCGG5 nmol¥38,000
INH0221hsa-miR-187-3p InhibitorUCGUGUCUUGUGUUGCAGCCGG5 nmol¥38,000
MIM0220hsa-miR-187-5p MimicGGCUACAACACAGGACCCGGGC5 nmol¥38,000
INH0220hsa-miR-187-5p InhibitorGGCUACAACACAGGACCCGGGC5 nmol¥38,000
MIM0223hsa-miR-188-3p MimicCUCCCACAUGCAGGGUUUGCA5 nmol¥38,000
INH0223hsa-miR-188-3p InhibitorCUCCCACAUGCAGGGUUUGCA5 nmol¥38,000
MIM0222hsa-miR-188-5p MimicCAUCCCUUGCAUGGUGGAGGG5 nmol¥38,000
INH0222hsa-miR-188-5p InhibitorCAUCCCUUGCAUGGUGGAGGG5 nmol¥38,000
MIM0224hsa-miR-190a MimicUGAUAUGUUUGAUAUAUUAGGU5 nmol¥38,000
INH0224hsa-miR-190a InhibitorUGAUAUGUUUGAUAUAUUAGGU5 nmol¥38,000
MIM0225hsa-miR-190b MimicUGAUAUGUUUGAUAUUGGGUU5 nmol¥38,000
INH0225hsa-miR-190b InhibitorUGAUAUGUUUGAUAUUGGGUU5 nmol¥38,000
MIM0227hsa-miR-191-3p MimicGCUGCGCUUGGAUUUCGUCCCC5 nmol¥38,000
INH0227hsa-miR-191-3p InhibitorGCUGCGCUUGGAUUUCGUCCCC5 nmol¥38,000
MIM0226hsa-miR-191-5p MimicCAACGGAAUCCCAAAAGCAGCUG5 nmol¥38,000
INH0226hsa-miR-191-5p InhibitorCAACGGAAUCCCAAAAGCAGCUG5 nmol¥38,000
MIM0229hsa-miR-192-3p MimicCUGCCAAUUCCAUAGGUCACAG5 nmol¥38,000
INH0229hsa-miR-192-3p InhibitorCUGCCAAUUCCAUAGGUCACAG5 nmol¥38,000
MIM0228hsa-miR-192-5p MimicCUGACCUAUGAAUUGACAGCC5 nmol¥38,000
INH0228hsa-miR-192-5p InhibitorCUGACCUAUGAAUUGACAGCC5 nmol¥38,000
MIM0231hsa-miR-193a-3p MimicAACUGGCCUACAAAGUCCCAGU5 nmol¥38,000
INH0231hsa-miR-193a-3p InhibitorAACUGGCCUACAAAGUCCCAGU5 nmol¥38,000
MIM0233hsa-miR-193a-5p MimicUGGGUCUUUGCGGGCGAGAUGA5 nmol¥38,000
INH0233hsa-miR-193a-5p InhibitorUGGGUCUUUGCGGGCGAGAUGA5 nmol¥38,000
MIM0230hsa-miR-193b-3p MimicAACUGGCCCUCAAAGUCCCGCU5 nmol¥38,000
INH0230hsa-miR-193b-3p InhibitorAACUGGCCCUCAAAGUCCCGCU5 nmol¥38,000
MIM0232hsa-miR-193b-5p MimicCGGGGUUUUGAGGGCGAGAUGA5 nmol¥38,000
INH0232hsa-miR-193b-5p InhibitorCGGGGUUUUGAGGGCGAGAUGA5 nmol¥38,000
MIM0234hsa-miR-194-3p MimicCCAGUGGGGCUGCUGUUAUCUG5 nmol¥38,000
INH0234hsa-miR-194-3p InhibitorCCAGUGGGGCUGCUGUUAUCUG5 nmol¥38,000
MIM0235hsa-miR-194-5p MimicUGUAACAGCAACUCCAUGUGGA5 nmol¥38,000
INH0235hsa-miR-194-5p InhibitorUGUAACAGCAACUCCAUGUGGA5 nmol¥38,000
MIM0236hsa-miR-195-3p MimicCCAAUAUUGGCUGUGCUGCUCC5 nmol¥38,000
INH0236hsa-miR-195-3p InhibitorCCAAUAUUGGCUGUGCUGCUCC5 nmol¥38,000
MIM0237hsa-miR-195-5p MimicUAGCAGCACAGAAAUAUUGGC5 nmol¥38,000
INH0237hsa-miR-195-5p InhibitorUAGCAGCACAGAAAUAUUGGC5 nmol¥38,000
MIM0238hsa-miR-196a-3p MimicCGGCAACAAGAAACUGCCUGAG5 nmol¥38,000
INH0238hsa-miR-196a-3p InhibitorCGGCAACAAGAAACUGCCUGAG5 nmol¥38,000
MIM0239hsa-miR-196a-5p MimicUAGGUAGUUUCAUGUUGUUGGG5 nmol¥38,000
INH0239hsa-miR-196a-5p InhibitorUAGGUAGUUUCAUGUUGUUGGG5 nmol¥38,000
MIM0241hsa-miR-196b-3p MimicUCGACAGCACGACACUGCCUUC5 nmol¥38,000
INH0241hsa-miR-196b-3p InhibitorUCGACAGCACGACACUGCCUUC5 nmol¥38,000
MIM0240hsa-miR-196b-5p MimicUAGGUAGUUUCCUGUUGUUGGG5 nmol¥38,000
INH0240hsa-miR-196b-5p InhibitorUAGGUAGUUUCCUGUUGUUGGG5 nmol¥38,000
MIM0242hsa-miR-197-3p MimicUUCACCACCUUCUCCACCCAGC5 nmol¥38,000
INH0242hsa-miR-197-3p InhibitorUUCACCACCUUCUCCACCCAGC5 nmol¥38,000
MIM0243hsa-miR-198 MimicGGUCCAGAGGGGAGAUAGGUUC5 nmol¥38,000
INH0243hsa-miR-198 InhibitorGGUCCAGAGGGGAGAUAGGUUC5 nmol¥38,000
MIM0244hsa-miR-199a-3p MimicACAGUAGUCUGCACAUUGGUUA5 nmol¥38,000
INH0244hsa-miR-199a-3p InhibitorACAGUAGUCUGCACAUUGGUUA5 nmol¥38,000
MIM0245hsa-miR-199a-5p MimicCCCAGUGUUCAGACUACCUGUUC5 nmol¥38,000
INH0245hsa-miR-199a-5p InhibitorCCCAGUGUUCAGACUACCUGUUC5 nmol¥38,000
MIM0246hsa-miR-199b-5p MimicCCCAGUGUUUAGACUAUCUGUUC5 nmol¥38,000
INH0246hsa-miR-199b-5p InhibitorCCCAGUGUUUAGACUAUCUGUUC5 nmol¥38,000