miR-200...miR-299

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0250hsa-miR-200a-3p MimicUAACACUGUCUGGUAACGAUGU5 nmol¥38,000
INH0250hsa-miR-200a-3p InhibitorUAACACUGUCUGGUAACGAUGU5 nmol¥38,000
MIM0247hsa-miR-200a-5p MimicCAUCUUACCGGACAGUGCUGGA5 nmol¥38,000
INH0247hsa-miR-200a-5p InhibitorCAUCUUACCGGACAGUGCUGGA5 nmol¥38,000
MIM0252hsa-miR-200b-3p MimicUAAUACUGCCUGGUAAUGAUGA5 nmol¥38,000
INH0252hsa-miR-200b-3p InhibitorUAAUACUGCCUGGUAAUGAUGA5 nmol¥38,000
MIM0248hsa-miR-200b-5p MimicCAUCUUACUGGGCAGCAUUGGA5 nmol¥38,000
INH0248hsa-miR-200b-5p InhibitorCAUCUUACUGGGCAGCAUUGGA5 nmol¥38,000
MIM0251hsa-miR-200c-3p MimicUAAUACUGCCGGGUAAUGAUGGA5 nmol¥38,000
INH0251hsa-miR-200c-3p InhibitorUAAUACUGCCGGGUAAUGAUGGA5 nmol¥38,000
MIM0249hsa-miR-200c-5p MimicCGUCUUACCCAGCAGUGUUUGG5 nmol¥38,000
INH0249hsa-miR-200c-5p InhibitorCGUCUUACCCAGCAGUGUUUGG5 nmol¥38,000
MIM0253hsa-miR-202-3p MimicAGAGGUAUAGGGCAUGGGAA5 nmol¥38,000
INH0253hsa-miR-202-3p InhibitorAGAGGUAUAGGGCAUGGGAA5 nmol¥38,000
MIM0254hsa-miR-202-5p MimicUUCCUAUGCAUAUACUUCUUUG5 nmol¥38,000
INH0254hsa-miR-202-5p InhibitorUUCCUAUGCAUAUACUUCUUUG5 nmol¥38,000
MIM0255hsa-miR-203 MimicGUGAAAUGUUUAGGACCACUAG5 nmol¥38,000
INH0255hsa-miR-203 InhibitorGUGAAAUGUUUAGGACCACUAG5 nmol¥38,000
MIM0256hsa-miR-204-5p MimicUUCCCUUUGUCAUCCUAUGCCU5 nmol¥38,000
INH0256hsa-miR-204-5p InhibitorUUCCCUUUGUCAUCCUAUGCCU5 nmol¥38,000
MIM0257hsa-miR-205-3p MimicGAUUUCAGUGGAGUGAAGUUC5 nmol¥38,000
INH0257hsa-miR-205-3p InhibitorGAUUUCAGUGGAGUGAAGUUC5 nmol¥38,000
MIM0258hsa-miR-205-5p MimicUCCUUCAUUCCACCGGAGUCUG5 nmol¥38,000
INH0258hsa-miR-205-5p InhibitorUCCUUCAUUCCACCGGAGUCUG5 nmol¥38,000
MIM0259hsa-miR-206 MimicUGGAAUGUAAGGAAGUGUGUGG5 nmol¥38,000
INH0259hsa-miR-206 InhibitorUGGAAUGUAAGGAAGUGUGUGG5 nmol¥38,000
MIM0261hsa-miR-208a MimicAUAAGACGAGCAAAAAGCUUGU5 nmol¥38,000
INH0261hsa-miR-208a InhibitorAUAAGACGAGCAAAAAGCUUGU5 nmol¥38,000
MIM0260hsa-miR-208b MimicAUAAGACGAACAAAAGGUUUGU5 nmol¥38,000
INH0260hsa-miR-208b InhibitorAUAAGACGAACAAAAGGUUUGU5 nmol¥38,000
MIM0262hsa-miR-210 MimicCUGUGCGUGUGACAGCGGCUGA5 nmol¥38,000
INH0262hsa-miR-210 InhibitorCUGUGCGUGUGACAGCGGCUGA5 nmol¥38,000
MIM0263hsa-miR-211-5p MimicUUCCCUUUGUCAUCCUUCGCCU5 nmol¥38,000
INH0263hsa-miR-211-5p InhibitorUUCCCUUUGUCAUCCUUCGCCU5 nmol¥38,000
MIM0264hsa-miR-212-3p MimicUAACAGUCUCCAGUCACGGCC5 nmol¥38,000
INH0264hsa-miR-212-3p InhibitorUAACAGUCUCCAGUCACGGCC5 nmol¥38,000
MIM0265hsa-miR-214-3p MimicACAGCAGGCACAGACAGGCAGU5 nmol¥38,000
INH0265hsa-miR-214-3p InhibitorACAGCAGGCACAGACAGGCAGU5 nmol¥38,000
MIM0266hsa-miR-214-5p MimicUGCCUGUCUACACUUGCUGUGC5 nmol¥38,000
INH0266hsa-miR-214-5p InhibitorUGCCUGUCUACACUUGCUGUGC5 nmol¥38,000
MIM0267hsa-miR-215 MimicAUGACCUAUGAAUUGACAGAC5 nmol¥38,000
INH0267hsa-miR-215 InhibitorAUGACCUAUGAAUUGACAGAC5 nmol¥38,000
MIM0269hsa-miR-216a MimicUAAUCUCAGCUGGCAACUGUGA5 nmol¥38,000
INH0269hsa-miR-216a InhibitorUAAUCUCAGCUGGCAACUGUGA5 nmol¥38,000
MIM0268hsa-miR-216b MimicAAAUCUCUGCAGGCAAAUGUGA5 nmol¥38,000
INH0268hsa-miR-216b InhibitorAAAUCUCUGCAGGCAAAUGUGA5 nmol¥38,000
MIM0270hsa-miR-217 MimicUACUGCAUCAGGAACUGAUUGGA5 nmol¥38,000
INH0270hsa-miR-217 InhibitorUACUGCAUCAGGAACUGAUUGGA5 nmol¥38,000
MIM0271hsa-miR-218-1-3p MimicAUGGUUCCGUCAAGCACCAUGG5 nmol¥38,000
INH0271hsa-miR-218-1-3p InhibitorAUGGUUCCGUCAAGCACCAUGG5 nmol¥38,000
MIM0272hsa-miR-218-2-3p MimicCAUGGUUCUGUCAAGCACCGCG5 nmol¥38,000
INH0272hsa-miR-218-2-3p InhibitorCAUGGUUCUGUCAAGCACCGCG5 nmol¥38,000
MIM0273hsa-miR-218-5p MimicUUGUGCUUGAUCUAACCAUGU5 nmol¥38,000
INH0273hsa-miR-218-5p InhibitorUUGUGCUUGAUCUAACCAUGU5 nmol¥38,000
MIM0275hsa-miR-219-1-3p MimicAGAGUUGAGUCUGGACGUCCCG5 nmol¥38,000
INH0275hsa-miR-219-1-3p InhibitorAGAGUUGAGUCUGGACGUCCCG5 nmol¥38,000
MIM0274hsa-miR-219-2-3p MimicAGAAUUGUGGCUGGACAUCUGU5 nmol¥38,000
INH0274hsa-miR-219-2-3p InhibitorAGAAUUGUGGCUGGACAUCUGU5 nmol¥38,000
MIM0276hsa-miR-219-5p MimicUGAUUGUCCAAACGCAAUUCU5 nmol¥38,000
INH0276hsa-miR-219-5p InhibitorUGAUUGUCCAAACGCAAUUCU5 nmol¥38,000
MIM0281hsa-miR-221-3p MimicAGCUACAUUGUCUGCUGGGUUUC5 nmol¥38,000
INH0281hsa-miR-221-3p InhibitorAGCUACAUUGUCUGCUGGGUUUC5 nmol¥38,000
MIM0280hsa-miR-221-5p MimicACCUGGCAUACAAUGUAGAUUU5 nmol¥38,000
INH0280hsa-miR-221-5p InhibitorACCUGGCAUACAAUGUAGAUUU5 nmol¥38,000
MIM0282hsa-miR-222-3p MimicAGCUACAUCUGGCUACUGGGU5 nmol¥38,000
INH0282hsa-miR-222-3p InhibitorAGCUACAUCUGGCUACUGGGU5 nmol¥38,000
MIM0283hsa-miR-222-5p MimicCUCAGUAGCCAGUGUAGAUCCU5 nmol¥38,000
INH0283hsa-miR-222-5p InhibitorCUCAGUAGCCAGUGUAGAUCCU5 nmol¥38,000
MIM0285hsa-miR-223-3p MimicUGUCAGUUUGUCAAAUACCCCA5 nmol¥38,000
INH0285hsa-miR-223-3p InhibitorUGUCAGUUUGUCAAAUACCCCA5 nmol¥38,000
MIM0284hsa-miR-223-5p MimicCGUGUAUUUGACAAGCUGAGUU5 nmol¥38,000
INH0284hsa-miR-223-5p InhibitorCGUGUAUUUGACAAGCUGAGUU5 nmol¥38,000
MIM0286hsa-miR-224-3p MimicAAAAUGGUGCCCUAGUGACUACA5 nmol¥38,000
INH0286hsa-miR-224-3p InhibitorAAAAUGGUGCCCUAGUGACUACA5 nmol¥38,000
MIM0287hsa-miR-224-5p MimicCAAGUCACUAGUGGUUCCGUU5 nmol¥38,000
INH0287hsa-miR-224-5p InhibitorCAAGUCACUAGUGGUUCCGUU5 nmol¥38,000
MIM0289hsa-miR-296-3p MimicGAGGGUUGGGUGGAGGCUCUCC5 nmol¥38,000
INH0289hsa-miR-296-3p InhibitorGAGGGUUGGGUGGAGGCUCUCC5 nmol¥38,000
MIM0288hsa-miR-296-5p MimicAGGGCCCCCCCUCAAUCCUGU5 nmol¥38,000
INH0288hsa-miR-296-5p InhibitorAGGGCCCCCCCUCAAUCCUGU5 nmol¥38,000
MIM0290hsa-miR-297 MimicAUGUAUGUGUGCAUGUGCAUG5 nmol¥38,000
INH0290hsa-miR-297 InhibitorAUGUAUGUGUGCAUGUGCAUG5 nmol¥38,000
MIM0291hsa-miR-298 MimicAGCAGAAGCAGGGAGGUUCUCCCA5 nmol¥38,000
INH0291hsa-miR-298 InhibitorAGCAGAAGCAGGGAGGUUCUCCCA5 nmol¥38,000
MIM0292hsa-miR-299-3p MimicUAUGUGGGAUGGUAAACCGCUU5 nmol¥38,000
INH0292hsa-miR-299-3p InhibitorUAUGUGGGAUGGUAAACCGCUU5 nmol¥38,000
MIM0293hsa-miR-299-5p MimicUGGUUUACCGUCCCACAUACAU5 nmol¥38,000
INH0293hsa-miR-299-5p InhibitorUGGUUUACCGUCCCACAUACAU5 nmol¥38,000