miR-300...miR-399

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0294hsa-miR-300 MimicUAUACAAGGGCAGACUCUCUCU5 nmol¥38,000
INH0294hsa-miR-300 InhibitorUAUACAAGGGCAGACUCUCUCU5 nmol¥38,000
MIM0295hsa-miR-301a-3p MimicCAGUGCAAUAGUAUUGUCAAAGC5 nmol¥38,000
INH0295hsa-miR-301a-3p InhibitorCAGUGCAAUAGUAUUGUCAAAGC5 nmol¥38,000
MIM0296hsa-miR-301b MimicCAGUGCAAUGAUAUUGUCAAAGC5 nmol¥38,000
INH0296hsa-miR-301b InhibitorCAGUGCAAUGAUAUUGUCAAAGC5 nmol¥38,000
MIM0304hsa-miR-302a-3p MimicUAAGUGCUUCCAUGUUUUGGUGA5 nmol¥38,000
INH0304hsa-miR-302a-3p InhibitorUAAGUGCUUCCAUGUUUUGGUGA5 nmol¥38,000
MIM0297hsa-miR-302a-5p MimicACUUAAACGUGGAUGUACUUGCU5 nmol¥38,000
INH0297hsa-miR-302a-5p InhibitorACUUAAACGUGGAUGUACUUGCU5 nmol¥38,000
MIM0303hsa-miR-302b-3p MimicUAAGUGCUUCCAUGUUUUAGUAG5 nmol¥38,000
INH0303hsa-miR-302b-3p InhibitorUAAGUGCUUCCAUGUUUUAGUAG5 nmol¥38,000
MIM0298hsa-miR-302b-5p MimicACUUUAACAUGGAAGUGCUUUC5 nmol¥38,000
INH0298hsa-miR-302b-5p InhibitorACUUUAACAUGGAAGUGCUUUC5 nmol¥38,000
MIM0301hsa-miR-302c-3p MimicUAAGUGCUUCCAUGUUUCAGUGG5 nmol¥38,000
INH0301hsa-miR-302c-3p InhibitorUAAGUGCUUCCAUGUUUCAGUGG5 nmol¥38,000
MIM0306hsa-miR-302c-5p MimicUUUAACAUGGGGGUACCUGCUG5 nmol¥38,000
INH0306hsa-miR-302c-5p InhibitorUUUAACAUGGGGGUACCUGCUG5 nmol¥38,000
MIM0302hsa-miR-302d-3p MimicUAAGUGCUUCCAUGUUUGAGUGU5 nmol¥38,000
INH0302hsa-miR-302d-3p InhibitorUAAGUGCUUCCAUGUUUGAGUGU5 nmol¥38,000
MIM0299hsa-miR-302d-5p MimicACUUUAACAUGGAGGCACUUGC5 nmol¥38,000
INH0299hsa-miR-302d-5p InhibitorACUUUAACAUGGAGGCACUUGC5 nmol¥38,000
MIM0300hsa-miR-302e MimicUAAGUGCUUCCAUGCUU5 nmol¥38,000
INH0300hsa-miR-302e InhibitorUAAGUGCUUCCAUGCUU5 nmol¥38,000
MIM0305hsa-miR-302f MimicUAAUUGCUUCCAUGUUU5 nmol¥38,000
INH0305hsa-miR-302f InhibitorUAAUUGCUUCCAUGUUU5 nmol¥38,000
MIM0309hsa-miR-320a MimicAAAAGCUGGGUUGAGAGGGCGA5 nmol¥38,000
INH0309hsa-miR-320a InhibitorAAAAGCUGGGUUGAGAGGGCGA5 nmol¥38,000
MIM0308hsa-miR-320b MimicAAAAGCUGGGUUGAGAGGGCAA5 nmol¥38,000
INH0308hsa-miR-320b InhibitorAAAAGCUGGGUUGAGAGGGCAA5 nmol¥38,000
MIM0310hsa-miR-320c MimicAAAAGCUGGGUUGAGAGGGU5 nmol¥38,000
INH0310hsa-miR-320c InhibitorAAAAGCUGGGUUGAGAGGGU5 nmol¥38,000
MIM0307hsa-miR-320d MimicAAAAGCUGGGUUGAGAGGA5 nmol¥38,000
INH0307hsa-miR-320d InhibitorAAAAGCUGGGUUGAGAGGA5 nmol¥38,000
MIM0312hsa-miR-323a-3p MimicCACAUUACACGGUCGACCUCU5 nmol¥38,000
INH0312hsa-miR-323a-3p InhibitorCACAUUACACGGUCGACCUCU5 nmol¥38,000
MIM0311hsa-miR-323a-5p MimicAGGUGGUCCGUGGCGCGUUCGC5 nmol¥38,000
INH0311hsa-miR-323a-5p InhibitorAGGUGGUCCGUGGCGCGUUCGC5 nmol¥38,000
MIM0313hsa-miR-324-3p MimicACUGCCCCAGGUGCUGCUGG5 nmol¥38,000
INH0313hsa-miR-324-3p InhibitorACUGCCCCAGGUGCUGCUGG5 nmol¥38,000
MIM0314hsa-miR-324-5p MimicCGCAUCCCCUAGGGCAUUGGUGU5 nmol¥38,000
INH0314hsa-miR-324-5p InhibitorCGCAUCCCCUAGGGCAUUGGUGU5 nmol¥38,000
MIM0315hsa-miR-325 MimicCCUAGUAGGUGUCCAGUAAGUGU5 nmol¥38,000
INH0315hsa-miR-325 InhibitorCCUAGUAGGUGUCCAGUAAGUGU5 nmol¥38,000
MIM0316hsa-miR-326 MimicCCUCUGGGCCCUUCCUCCAG5 nmol¥38,000
INH0316hsa-miR-326 InhibitorCCUCUGGGCCCUUCCUCCAG5 nmol¥38,000
MIM0317hsa-miR-328 MimicCUGGCCCUCUCUGCCCUUCCGU5 nmol¥38,000
INH0317hsa-miR-328 InhibitorCUGGCCCUCUCUGCCCUUCCGU5 nmol¥38,000
MIM0318hsa-miR-329 MimicAACACACCUGGUUAACCUCUUU5 nmol¥38,000
INH0318hsa-miR-329 InhibitorAACACACCUGGUUAACCUCUUU5 nmol¥38,000
MIM0319hsa-miR-330-3p MimicGCAAAGCACACGGCCUGCAGAGA5 nmol¥38,000
INH0319hsa-miR-330-3p InhibitorGCAAAGCACACGGCCUGCAGAGA5 nmol¥38,000
MIM0320hsa-miR-330-5p MimicUCUCUGGGCCUGUGUCUUAGGC5 nmol¥38,000
INH0320hsa-miR-330-5p InhibitorUCUCUGGGCCUGUGUCUUAGGC5 nmol¥38,000
MIM0322hsa-miR-331-3p MimicGCCCCUGGGCCUAUCCUAGAA5 nmol¥38,000
INH0322hsa-miR-331-3p InhibitorGCCCCUGGGCCUAUCCUAGAA5 nmol¥38,000
MIM0321hsa-miR-331-5p MimicCUAGGUAUGGUCCCAGGGAUCC5 nmol¥38,000
INH0321hsa-miR-331-5p InhibitorCUAGGUAUGGUCCCAGGGAUCC5 nmol¥38,000
MIM0323hsa-miR-335-5p MimicUCAAGAGCAAUAACGAAAAAUGU5 nmol¥38,000
INH0323hsa-miR-335-5p InhibitorUCAAGAGCAAUAACGAAAAAUGU5 nmol¥38,000
MIM0324hsa-miR-337-3p MimicCUCCUAUAUGAUGCCUUUCUUC5 nmol¥38,000
INH0324hsa-miR-337-3p InhibitorCUCCUAUAUGAUGCCUUUCUUC5 nmol¥38,000
MIM0325hsa-miR-337-5p MimicGAACGGCUUCAUACAGGAGUU5 nmol¥38,000
INH0325hsa-miR-337-5p InhibitorGAACGGCUUCAUACAGGAGUU5 nmol¥38,000
MIM0327hsa-miR-338-3p MimicUCCAGCAUCAGUGAUUUUGUUG5 nmol¥38,000
INH0327hsa-miR-338-3p InhibitorUCCAGCAUCAGUGAUUUUGUUG5 nmol¥38,000
MIM0326hsa-miR-338-5p MimicAACAAUAUCCUGGUGCUGAGUG5 nmol¥38,000
INH0326hsa-miR-338-5p InhibitorAACAAUAUCCUGGUGCUGAGUG5 nmol¥38,000
MIM0329hsa-miR-339-3p MimicUGAGCGCCUCGACGACAGAGCCG5 nmol¥38,000
INH0329hsa-miR-339-3p InhibitorUGAGCGCCUCGACGACAGAGCCG5 nmol¥38,000
MIM0328hsa-miR-339-5p MimicUCCCUGUCCUCCAGGAGCUCACG5 nmol¥38,000
INH0328hsa-miR-339-5p InhibitorUCCCUGUCCUCCAGGAGCUCACG5 nmol¥38,000
MIM0330hsa-miR-340-3p MimicUCCGUCUCAGUUACUUUAUAGC5 nmol¥38,000
INH0330hsa-miR-340-3p InhibitorUCCGUCUCAGUUACUUUAUAGC5 nmol¥38,000
MIM0331hsa-miR-340-5p MimicUUAUAAAGCAAUGAGACUGAUU5 nmol¥38,000
INH0331hsa-miR-340-5p InhibitorUUAUAAAGCAAUGAGACUGAUU5 nmol¥38,000
MIM0333hsa-miR-342-3p MimicUCUCACACAGAAAUCGCACCCGU5 nmol¥38,000
INH0333hsa-miR-342-3p InhibitorUCUCACACAGAAAUCGCACCCGU5 nmol¥38,000
MIM0332hsa-miR-342-5p MimicAGGGGUGCUAUCUGUGAUUGA5 nmol¥38,000
INH0332hsa-miR-342-5p InhibitorAGGGGUGCUAUCUGUGAUUGA5 nmol¥38,000
MIM0334hsa-miR-345-5p MimicGCUGACUCCUAGUCCAGGGCUC5 nmol¥38,000
INH0334hsa-miR-345-5p InhibitorGCUGACUCCUAGUCCAGGGCUC5 nmol¥38,000
MIM0335hsa-miR-346 MimicUGUCUGCCCGCAUGCCUGCCUCU5 nmol¥38,000
INH0335hsa-miR-346 InhibitorUGUCUGCCCGCAUGCCUGCCUCU5 nmol¥38,000
MIM0336hsa-miR-361-3p MimicUCCCCCAGGUGUGAUUCUGAUUU5 nmol¥38,000
INH0336hsa-miR-361-3p InhibitorUCCCCCAGGUGUGAUUCUGAUUU5 nmol¥38,000
MIM0337hsa-miR-361-5p MimicUUAUCAGAAUCUCCAGGGGUAC5 nmol¥38,000
INH0337hsa-miR-361-5p InhibitorUUAUCAGAAUCUCCAGGGGUAC5 nmol¥38,000
MIM0338hsa-miR-362-3p MimicAACACACCUAUUCAAGGAUUCA5 nmol¥38,000
INH0338hsa-miR-362-3p InhibitorAACACACCUAUUCAAGGAUUCA5 nmol¥38,000
MIM0339hsa-miR-362-5p MimicAAUCCUUGGAACCUAGGUGUGAGU5 nmol¥38,000
INH0339hsa-miR-362-5p InhibitorAAUCCUUGGAACCUAGGUGUGAGU5 nmol¥38,000
MIM0340hsa-miR-363-3p MimicAAUUGCACGGUAUCCAUCUGUA5 nmol¥38,000
INH0340hsa-miR-363-3p InhibitorAAUUGCACGGUAUCCAUCUGUA5 nmol¥38,000
MIM0341hsa-miR-363-5p MimicCGGGUGGAUCACGAUGCAAUUU5 nmol¥38,000
INH0341hsa-miR-363-5p InhibitorCGGGUGGAUCACGAUGCAAUUU5 nmol¥38,000
MIM0343hsa-miR-365a-3p MimicUAAUGCCCCUAAAAAUCCUUAU5 nmol¥38,000
INH0343hsa-miR-365a-3p InhibitorUAAUGCCCCUAAAAAUCCUUAU5 nmol¥38,000
MIM0342hsa-miR-365a-5p MimicAGGGACUUUUGGGGGCAGAUGUG5 nmol¥38,000
INH0342hsa-miR-365a-5p InhibitorAGGGACUUUUGGGGGCAGAUGUG5 nmol¥38,000
MIM0344hsa-miR-367-3p MimicAAUUGCACUUUAGCAAUGGUGA5 nmol¥38,000
INH0344hsa-miR-367-3p InhibitorAAUUGCACUUUAGCAAUGGUGA5 nmol¥38,000
MIM0345hsa-miR-367-5p MimicACUGUUGCUAAUAUGCAACUCU5 nmol¥38,000
INH0345hsa-miR-367-5p InhibitorACUGUUGCUAAUAUGCAACUCU5 nmol¥38,000
MIM0346hsa-miR-369-3p MimicAAUAAUACAUGGUUGAUCUUU5 nmol¥38,000
INH0346hsa-miR-369-3p InhibitorAAUAAUACAUGGUUGAUCUUU5 nmol¥38,000
MIM0347hsa-miR-369-5p MimicAGAUCGACCGUGUUAUAUUCGC5 nmol¥38,000
INH0347hsa-miR-369-5p InhibitorAGAUCGACCGUGUUAUAUUCGC5 nmol¥38,000
MIM0348hsa-miR-370 MimicGCCUGCUGGGGUGGAACCUGGU5 nmol¥38,000
INH0348hsa-miR-370 InhibitorGCCUGCUGGGGUGGAACCUGGU5 nmol¥38,000
MIM0349hsa-miR-371a-3p MimicAAGUGCCGCCAUCUUUUGAGUGU5 nmol¥38,000
INH0349hsa-miR-371a-3p InhibitorAAGUGCCGCCAUCUUUUGAGUGU5 nmol¥38,000
MIM0350hsa-miR-371a-5p MimicACUCAAACUGUGGGGGCACU5 nmol¥38,000
INH0350hsa-miR-371a-5p InhibitorACUCAAACUGUGGGGGCACU5 nmol¥38,000
MIM0351hsa-miR-372 MimicAAAGUGCUGCGACAUUUGAGCGU5 nmol¥38,000
INH0351hsa-miR-372 InhibitorAAAGUGCUGCGACAUUUGAGCGU5 nmol¥38,000
MIM0353hsa-miR-373-3p MimicGAAGUGCUUCGAUUUUGGGGUGU5 nmol¥38,000
INH0353hsa-miR-373-3p InhibitorGAAGUGCUUCGAUUUUGGGGUGU5 nmol¥38,000
MIM0352hsa-miR-373-5p MimicACUCAAAAUGGGGGCGCUUUCC5 nmol¥38,000
INH0352hsa-miR-373-5p InhibitorACUCAAAAUGGGGGCGCUUUCC5 nmol¥38,000
MIM0356hsa-miR-374a-3p MimicCUUAUCAGAUUGUAUUGUAAUU5 nmol¥38,000
INH0356hsa-miR-374a-3p InhibitorCUUAUCAGAUUGUAUUGUAAUU5 nmol¥38,000
MIM0357hsa-miR-374a-5p MimicUUAUAAUACAACCUGAUAAGUG5 nmol¥38,000
INH0357hsa-miR-374a-5p InhibitorUUAUAAUACAACCUGAUAAGUG5 nmol¥38,000
MIM0355hsa-miR-374b-3p MimicCUUAGCAGGUUGUAUUAUCAUU5 nmol¥38,000
INH0355hsa-miR-374b-3p InhibitorCUUAGCAGGUUGUAUUAUCAUU5 nmol¥38,000
MIM0354hsa-miR-374b-5p MimicAUAUAAUACAACCUGCUAAGUG5 nmol¥38,000
INH0354hsa-miR-374b-5p InhibitorAUAUAAUACAACCUGCUAAGUG5 nmol¥38,000
MIM0865hsa-miR-375 MimicUUUGUUCGUUCGGCUCGCGUGA5 nmol¥38,000
INH0865hsa-miR-375 InhibitorUUUGUUCGUUCGGCUCGCGUGA5 nmol¥38,000
MIM0359hsa-miR-376a-3p MimicAUCAUAGAGGAAAAUCCACGU5 nmol¥38,000
INH0359hsa-miR-376a-3p InhibitorAUCAUAGAGGAAAAUCCACGU5 nmol¥38,000
MIM0361hsa-miR-376a-5p MimicGUAGAUUCUCCUUCUAUGAGUA5 nmol¥38,000
INH0361hsa-miR-376a-5p InhibitorGUAGAUUCUCCUUCUAUGAGUA5 nmol¥38,000
MIM0360hsa-miR-376b MimicAUCAUAGAGGAAAAUCCAUGUU5 nmol¥38,000
INH0360hsa-miR-376b InhibitorAUCAUAGAGGAAAAUCCAUGUU5 nmol¥38,000
MIM0358hsa-miR-376c MimicAACAUAGAGGAAAUUCCACGU5 nmol¥38,000
INH0358hsa-miR-376c InhibitorAACAUAGAGGAAAUUCCACGU5 nmol¥38,000
MIM0363hsa-miR-377-3p MimicAUCACACAAAGGCAACUUUUGU5 nmol¥38,000
INH0363hsa-miR-377-3p InhibitorAUCACACAAAGGCAACUUUUGU5 nmol¥38,000
MIM0362hsa-miR-377-5p MimicAGAGGUUGCCCUUGGUGAAUUC5 nmol¥38,000
INH0362hsa-miR-377-5p InhibitorAGAGGUUGCCCUUGGUGAAUUC5 nmol¥38,000
MIM0364hsa-miR-378a-3p MimicACUGGACUUGGAGUCAGAAGG5 nmol¥38,000
INH0364hsa-miR-378a-3p InhibitorACUGGACUUGGAGUCAGAAGG5 nmol¥38,000
MIM0365hsa-miR-378a-5p MimicCUCCUGACUCCAGGUCCUGUGU5 nmol¥38,000
INH0365hsa-miR-378a-5p InhibitorCUCCUGACUCCAGGUCCUGUGU5 nmol¥38,000
MIM0366hsa-miR-379-3p MimicUAUGUAACAUGGUCCACUAACU5 nmol¥38,000
INH0366hsa-miR-379-3p InhibitorUAUGUAACAUGGUCCACUAACU5 nmol¥38,000
MIM0367hsa-miR-379-5p MimicUGGUAGACUAUGGAACGUAGG5 nmol¥38,000
INH0367hsa-miR-379-5p InhibitorUGGUAGACUAUGGAACGUAGG5 nmol¥38,000
MIM0368hsa-miR-380-3p MimicUAUGUAAUAUGGUCCACAUCUU5 nmol¥38,000
INH0368hsa-miR-380-3p InhibitorUAUGUAAUAUGGUCCACAUCUU5 nmol¥38,000
MIM0369hsa-miR-380-5p MimicUGGUUGACCAUAGAACAUGCGC5 nmol¥38,000
INH0369hsa-miR-380-5p InhibitorUGGUUGACCAUAGAACAUGCGC5 nmol¥38,000
MIM0370hsa-miR-381 MimicUAUACAAGGGCAAGCUCUCUGU5 nmol¥38,000
INH0370hsa-miR-381 InhibitorUAUACAAGGGCAAGCUCUCUGU5 nmol¥38,000
MIM0371hsa-miR-382-5p MimicGAAGUUGUUCGUGGUGGAUUCG5 nmol¥38,000
INH0371hsa-miR-382-5p InhibitorGAAGUUGUUCGUGGUGGAUUCG5 nmol¥38,000
MIM0372hsa-miR-383 MimicAGAUCAGAAGGUGAUUGUGGCU5 nmol¥38,000
INH0372hsa-miR-383 InhibitorAGAUCAGAAGGUGAUUGUGGCU5 nmol¥38,000
MIM0373hsa-miR-384 MimicAUUCCUAGAAAUUGUUCAUA5 nmol¥38,000
INH0373hsa-miR-384 InhibitorAUUCCUAGAAAUUGUUCAUA5 nmol¥38,000