miR-400...miR-499

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0375hsa-miR-409-3p MimicGAAUGUUGCUCGGUGAACCCCU5 nmol¥38,000
INH0375hsa-miR-409-3p InhibitorGAAUGUUGCUCGGUGAACCCCU5 nmol¥38,000
MIM0374hsa-miR-409-5p MimicAGGUUACCCGAGCAACUUUGCAU5 nmol¥38,000
INH0374hsa-miR-409-5p InhibitorAGGUUACCCGAGCAACUUUGCAU5 nmol¥38,000
MIM0376hsa-miR-410 MimicAAUAUAACACAGAUGGCCUGU5 nmol¥38,000
INH0376hsa-miR-410 InhibitorAAUAUAACACAGAUGGCCUGU5 nmol¥38,000
MIM0378hsa-miR-411-3p MimicUAUGUAACACGGUCCACUAACC5 nmol¥38,000
INH0378hsa-miR-411-3p InhibitorUAUGUAACACGGUCCACUAACC5 nmol¥38,000
MIM0377hsa-miR-411-5p MimicUAGUAGACCGUAUAGCGUACG5 nmol¥38,000
INH0377hsa-miR-411-5p InhibitorUAGUAGACCGUAUAGCGUACG5 nmol¥38,000
MIM0379hsa-miR-412 MimicACUUCACCUGGUCCACUAGCCGU5 nmol¥38,000
INH0379hsa-miR-412 InhibitorACUUCACCUGGUCCACUAGCCGU5 nmol¥38,000
MIM0380hsa-miR-421 MimicAUCAACAGACAUUAAUUGGGCGC5 nmol¥38,000
INH0380hsa-miR-421 InhibitorAUCAACAGACAUUAAUUGGGCGC5 nmol¥38,000
MIM0381hsa-miR-422a MimicACUGGACUUAGGGUCAGAAGGC5 nmol¥38,000
INH0381hsa-miR-422a InhibitorACUGGACUUAGGGUCAGAAGGC5 nmol¥38,000
MIM0382hsa-miR-423-3p MimicAGCUCGGUCUGAGGCCCCUCAGU5 nmol¥38,000
INH0382hsa-miR-423-3p InhibitorAGCUCGGUCUGAGGCCCCUCAGU5 nmol¥38,000
MIM0383hsa-miR-423-5p MimicUGAGGGGCAGAGAGCGAGACUUU5 nmol¥38,000
INH0383hsa-miR-423-5p InhibitorUGAGGGGCAGAGAGCGAGACUUU5 nmol¥38,000
MIM0384hsa-miR-424-3p MimicCAAAACGUGAGGCGCUGCUAU5 nmol¥38,000
INH0384hsa-miR-424-3p InhibitorCAAAACGUGAGGCGCUGCUAU5 nmol¥38,000
MIM0385hsa-miR-424-5p MimicCAGCAGCAAUUCAUGUUUUGAA5 nmol¥38,000
INH0385hsa-miR-424-5p InhibitorCAGCAGCAAUUCAUGUUUUGAA5 nmol¥38,000
MIM0387hsa-miR-425-3p MimicAUCGGGAAUGUCGUGUCCGCCC5 nmol¥38,000
INH0387hsa-miR-425-3p InhibitorAUCGGGAAUGUCGUGUCCGCCC5 nmol¥38,000
MIM0386hsa-miR-425-5p MimicAAUGACACGAUCACUCCCGUUGA5 nmol¥38,000
INH0386hsa-miR-425-5p InhibitorAAUGACACGAUCACUCCCGUUGA5 nmol¥38,000
MIM0388hsa-miR-429 MimicUAAUACUGUCUGGUAAAACCGU5 nmol¥38,000
INH0388hsa-miR-429 InhibitorUAAUACUGUCUGGUAAAACCGU5 nmol¥38,000
MIM0389hsa-miR-431-3p MimicCAGGUCGUCUUGCAGGGCUUCU5 nmol¥38,000
INH0389hsa-miR-431-3p InhibitorCAGGUCGUCUUGCAGGGCUUCU5 nmol¥38,000
MIM0390hsa-miR-431-5p MimicUGUCUUGCAGGCCGUCAUGCA5 nmol¥38,000
INH0390hsa-miR-431-5p InhibitorUGUCUUGCAGGCCGUCAUGCA5 nmol¥38,000
MIM0391hsa-miR-432-3p MimicCUGGAUGGCUCCUCCAUGUCU5 nmol¥38,000
INH0391hsa-miR-432-3p InhibitorCUGGAUGGCUCCUCCAUGUCU5 nmol¥38,000
MIM0392hsa-miR-432-5p MimicUCUUGGAGUAGGUCAUUGGGUGG5 nmol¥38,000
INH0392hsa-miR-432-5p InhibitorUCUUGGAGUAGGUCAUUGGGUGG5 nmol¥38,000
MIM0393hsa-miR-433 MimicAUCAUGAUGGGCUCCUCGGUGU5 nmol¥38,000
INH0393hsa-miR-433 InhibitorAUCAUGAUGGGCUCCUCGGUGU5 nmol¥38,000
MIM0394hsa-miR-448 MimicUUGCAUAUGUAGGAUGUCCCAU5 nmol¥38,000
INH0394hsa-miR-448 InhibitorUUGCAUAUGUAGGAUGUCCCAU5 nmol¥38,000
MIM0397hsa-miR-449a MimicUGGCAGUGUAUUGUUAGCUGGU5 nmol¥38,000
INH0397hsa-miR-449a InhibitorUGGCAGUGUAUUGUUAGCUGGU5 nmol¥38,000
MIM0396hsa-miR-449b-3p MimicCAGCCACAACUACCCUGCCACU5 nmol¥38,000
INH0396hsa-miR-449b-3p InhibitorCAGCCACAACUACCCUGCCACU5 nmol¥38,000
MIM0395hsa-miR-449b-5p MimicAGGCAGUGUAUUGUUAGCUGGC5 nmol¥38,000
INH0395hsa-miR-449b-5p InhibitorAGGCAGUGUAUUGUUAGCUGGC5 nmol¥38,000
MIM0398hsa-miR-450b-3p MimicUUGGGAUCAUUUUGCAUCCAUA5 nmol¥38,000
INH0398hsa-miR-450b-3p InhibitorUUGGGAUCAUUUUGCAUCCAUA5 nmol¥38,000
MIM0399hsa-miR-451a MimicAAACCGUUACCAUUACUGAGUU5 nmol¥38,000
INH0399hsa-miR-451a InhibitorAAACCGUUACCAUUACUGAGUU5 nmol¥38,000
MIM0401hsa-miR-452-3p MimicCUCAUCUGCAAAGAAGUAAGUG5 nmol¥38,000
INH0401hsa-miR-452-3p InhibitorCUCAUCUGCAAAGAAGUAAGUG5 nmol¥38,000
MIM0400hsa-miR-452-5p MimicAACUGUUUGCAGAGGAAACUGA5 nmol¥38,000
INH0400hsa-miR-452-5p InhibitorAACUGUUUGCAGAGGAAACUGA5 nmol¥38,000
MIM0404hsa-miR-454-3p MimicUAGUGCAAUAUUGCUUAUAGGGU5 nmol¥38,000
INH0404hsa-miR-454-3p InhibitorUAGUGCAAUAUUGCUUAUAGGGU5 nmol¥38,000
MIM0403hsa-miR-454-5p MimicACCCUAUCAAUAUUGUCUCUGC5 nmol¥38,000
INH0403hsa-miR-454-5p InhibitorACCCUAUCAAUAUUGUCUCUGC5 nmol¥38,000
MIM0405hsa-miR-455-3p MimicGCAGUCCAUGGGCAUAUACAC5 nmol¥38,000
INH0405hsa-miR-455-3p InhibitorGCAGUCCAUGGGCAUAUACAC5 nmol¥38,000
MIM0406hsa-miR-455-5p MimicUAUGUGCCUUUGGACUACAUCG5 nmol¥38,000
INH0406hsa-miR-455-5p InhibitorUAUGUGCCUUUGGACUACAUCG5 nmol¥38,000
MIM0408hsa-miR-483-3p MimicUCACUCCUCUCCUCCCGUCUU5 nmol¥38,000
INH0408hsa-miR-483-3p InhibitorUCACUCCUCUCCUCCCGUCUU5 nmol¥38,000
MIM0407hsa-miR-483-5p MimicAAGACGGGAGGAAAGAAGGGAG5 nmol¥38,000
INH0407hsa-miR-483-5p InhibitorAAGACGGGAGGAAAGAAGGGAG5 nmol¥38,000
MIM0409hsa-miR-484 MimicUCAGGCUCAGUCCCCUCCCGAU5 nmol¥38,000
INH0409hsa-miR-484 InhibitorUCAGGCUCAGUCCCCUCCCGAU5 nmol¥38,000
MIM0411hsa-miR-485-3p MimicGUCAUACACGGCUCUCCUCUCU5 nmol¥38,000
INH0411hsa-miR-485-3p InhibitorGUCAUACACGGCUCUCCUCUCU5 nmol¥38,000
MIM0410hsa-miR-485-5p MimicAGAGGCUGGCCGUGAUGAAUUC5 nmol¥38,000
INH0410hsa-miR-485-5p InhibitorAGAGGCUGGCCGUGAUGAAUUC5 nmol¥38,000
MIM0412hsa-miR-486-3p MimicCGGGGCAGCUCAGUACAGGAU5 nmol¥38,000
INH0412hsa-miR-486-3p InhibitorCGGGGCAGCUCAGUACAGGAU5 nmol¥38,000
MIM0413hsa-miR-486-5p MimicUCCUGUACUGAGCUGCCCCGAG5 nmol¥38,000
INH0413hsa-miR-486-5p InhibitorUCCUGUACUGAGCUGCCCCGAG5 nmol¥38,000
MIM0414hsa-miR-487a MimicAAUCAUACAGGGACAUCCAGUU5 nmol¥38,000
INH0414hsa-miR-487a InhibitorAAUCAUACAGGGACAUCCAGUU5 nmol¥38,000
MIM0415hsa-miR-487b MimicAAUCGUACAGGGUCAUCCACUU5 nmol¥38,000
INH0415hsa-miR-487b InhibitorAAUCGUACAGGGUCAUCCACUU5 nmol¥38,000
MIM0417hsa-miR-488-3p MimicUUGAAAGGCUAUUUCUUGGUC5 nmol¥38,000
INH0417hsa-miR-488-3p InhibitorUUGAAAGGCUAUUUCUUGGUC5 nmol¥38,000
MIM0416hsa-miR-488-5p MimicCCCAGAUAAUGGCACUCUCAA5 nmol¥38,000
INH0416hsa-miR-488-5p InhibitorCCCAGAUAAUGGCACUCUCAA5 nmol¥38,000
MIM0418hsa-miR-489 MimicGUGACAUCACAUAUACGGCAGC5 nmol¥38,000
INH0418hsa-miR-489 InhibitorGUGACAUCACAUAUACGGCAGC5 nmol¥38,000
MIM0419hsa-miR-490-3p MimicCAACCUGGAGGACUCCAUGCUG5 nmol¥38,000
INH0419hsa-miR-490-3p InhibitorCAACCUGGAGGACUCCAUGCUG5 nmol¥38,000
MIM0420hsa-miR-490-5p MimicCCAUGGAUCUCCAGGUGGGU5 nmol¥38,000
INH0420hsa-miR-490-5p InhibitorCCAUGGAUCUCCAGGUGGGU5 nmol¥38,000
MIM0422hsa-miR-491-3p MimicCUUAUGCAAGAUUCCCUUCUAC5 nmol¥38,000
INH0422hsa-miR-491-3p InhibitorCUUAUGCAAGAUUCCCUUCUAC5 nmol¥38,000
MIM0421hsa-miR-491-5p MimicAGUGGGGAACCCUUCCAUGAGG5 nmol¥38,000
INH0421hsa-miR-491-5p InhibitorAGUGGGGAACCCUUCCAUGAGG5 nmol¥38,000
MIM0423hsa-miR-492 MimicAGGACCUGCGGGACAAGAUUCUU5 nmol¥38,000
INH0423hsa-miR-492 InhibitorAGGACCUGCGGGACAAGAUUCUU5 nmol¥38,000
MIM0424hsa-miR-493-3p MimicUGAAGGUCUACUGUGUGCCAGG5 nmol¥38,000
INH0424hsa-miR-493-3p InhibitorUGAAGGUCUACUGUGUGCCAGG5 nmol¥38,000
MIM0425hsa-miR-493-5p MimicUUGUACAUGGUAGGCUUUCAUU5 nmol¥38,000
INH0425hsa-miR-493-5p InhibitorUUGUACAUGGUAGGCUUUCAUU5 nmol¥38,000
MIM0426hsa-miR-494 MimicUGAAACAUACACGGGAAACCUC5 nmol¥38,000
INH0426hsa-miR-494 InhibitorUGAAACAUACACGGGAAACCUC5 nmol¥38,000
MIM0427hsa-miR-495 MimicAAACAAACAUGGUGCACUUCUU5 nmol¥38,000
INH0427hsa-miR-495 InhibitorAAACAAACAUGGUGCACUUCUU5 nmol¥38,000
MIM0428hsa-miR-496 MimicUGAGUAUUACAUGGCCAAUCUC5 nmol¥38,000
INH0428hsa-miR-496 InhibitorUGAGUAUUACAUGGCCAAUCUC5 nmol¥38,000
MIM0429hsa-miR-497-3p MimicCAAACCACACUGUGGUGUUAGA5 nmol¥38,000
INH0429hsa-miR-497-3p InhibitorCAAACCACACUGUGGUGUUAGA5 nmol¥38,000
MIM0430hsa-miR-497-5p MimicCAGCAGCACACUGUGGUUUGU5 nmol¥38,000
INH0430hsa-miR-497-5p InhibitorCAGCAGCACACUGUGGUUUGU5 nmol¥38,000
MIM0431hsa-miR-498 MimicUUUCAAGCCAGGGGGCGUUUUUC5 nmol¥38,000
INH0431hsa-miR-498 InhibitorUUUCAAGCCAGGGGGCGUUUUUC5 nmol¥38,000
MIM0432hsa-miR-499a-3p MimicAACAUCACAGCAAGUCUGUGCU5 nmol¥38,000
INH0432hsa-miR-499a-3p InhibitorAACAUCACAGCAAGUCUGUGCU5 nmol¥38,000
MIM0433hsa-miR-499a-5p MimicUUAAGACUUGCAGUGAUGUUU5 nmol¥38,000
INH0433hsa-miR-499a-5p InhibitorUUAAGACUUGCAGUGAUGUUU5 nmol¥38,000