miR-500...miR-599

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0437hsa-miR-501-3p MimicAAUGCACCCGGGCAAGGAUUCU5 nmol¥38,000
INH0437hsa-miR-501-3p InhibitorAAUGCACCCGGGCAAGGAUUCU5 nmol¥38,000
MIM0436hsa-miR-501-5p MimicAAUCCUUUGUCCCUGGGUGAGA5 nmol¥38,000
INH0436hsa-miR-501-5p InhibitorAAUCCUUUGUCCCUGGGUGAGA5 nmol¥38,000
MIM0438hsa-miR-502-3p MimicAAUGCACCUGGGCAAGGAUUCA5 nmol¥38,000
INH0438hsa-miR-502-3p InhibitorAAUGCACCUGGGCAAGGAUUCA5 nmol¥38,000
MIM0439hsa-miR-502-5p MimicAUCCUUGCUAUCUGGGUGCUA5 nmol¥38,000
INH0439hsa-miR-502-5p InhibitorAUCCUUGCUAUCUGGGUGCUA5 nmol¥38,000
MIM0440hsa-miR-503 MimicUAGCAGCGGGAACAGUUCUGCAG5 nmol¥38,000
INH0440hsa-miR-503 InhibitorUAGCAGCGGGAACAGUUCUGCAG5 nmol¥38,000
MIM0441hsa-miR-504 MimicAGACCCUGGUCUGCACUCUAUC5 nmol¥38,000
INH0441hsa-miR-504 InhibitorAGACCCUGGUCUGCACUCUAUC5 nmol¥38,000
MIM0442hsa-miR-505-3p MimicCGUCAACACUUGCUGGUUUCCU5 nmol¥38,000
INH0442hsa-miR-505-3p InhibitorCGUCAACACUUGCUGGUUUCCU5 nmol¥38,000
MIM0443hsa-miR-505-5p MimicGGGAGCCAGGAAGUAUUGAUGU5 nmol¥38,000
INH0443hsa-miR-505-5p InhibitorGGGAGCCAGGAAGUAUUGAUGU5 nmol¥38,000
MIM0444hsa-miR-506-3p MimicUAAGGCACCCUUCUGAGUAGA5 nmol¥38,000
INH0444hsa-miR-506-3p InhibitorUAAGGCACCCUUCUGAGUAGA5 nmol¥38,000
MIM0446hsa-miR-508-3p MimicUGAUUGUAGCCUUUUGGAGUAGA5 nmol¥38,000
INH0446hsa-miR-508-3p InhibitorUGAUUGUAGCCUUUUGGAGUAGA5 nmol¥38,000
MIM0445hsa-miR-508-5p MimicUACUCCAGAGGGCGUCACUCAUG5 nmol¥38,000
INH0445hsa-miR-508-5p InhibitorUACUCCAGAGGGCGUCACUCAUG5 nmol¥38,000
MIM0448hsa-miR-509-3-5p MimicUACUGCAGACGUGGCAAUCAUG5 nmol¥38,000
INH0448hsa-miR-509-3-5p InhibitorUACUGCAGACGUGGCAAUCAUG5 nmol¥38,000
MIM0449hsa-miR-509-3p MimicUGAUUGGUACGUCUGUGGGUAG5 nmol¥38,000
INH0449hsa-miR-509-3p InhibitorUGAUUGGUACGUCUGUGGGUAG5 nmol¥38,000
MIM0447hsa-miR-509-5p MimicUACUGCAGACAGUGGCAAUCA5 nmol¥38,000
INH0447hsa-miR-509-5p InhibitorUACUGCAGACAGUGGCAAUCA5 nmol¥38,000
MIM0450hsa-miR-510 MimicUACUCAGGAGAGUGGCAAUCAC5 nmol¥38,000
INH0450hsa-miR-510 InhibitorUACUCAGGAGAGUGGCAAUCAC5 nmol¥38,000
MIM0451hsa-miR-511 MimicGUGUCUUUUGCUCUGCAGUCA5 nmol¥38,000
INH0451hsa-miR-511 InhibitorGUGUCUUUUGCUCUGCAGUCA5 nmol¥38,000
MIM0452hsa-miR-512-3p MimicAAGUGCUGUCAUAGCUGAGGUC5 nmol¥38,000
INH0452hsa-miR-512-3p InhibitorAAGUGCUGUCAUAGCUGAGGUC5 nmol¥38,000
MIM0453hsa-miR-512-5p MimicCACUCAGCCUUGAGGGCACUUUC5 nmol¥38,000
INH0453hsa-miR-512-5p InhibitorCACUCAGCCUUGAGGGCACUUUC5 nmol¥38,000
MIM0454hsa-miR-513a-3p MimicUAAAUUUCACCUUUCUGAGAAGG5 nmol¥38,000
INH0454hsa-miR-513a-3p InhibitorUAAAUUUCACCUUUCUGAGAAGG5 nmol¥38,000
MIM0456hsa-miR-513a-5p MimicUUCACAGGGAGGUGUCAU5 nmol¥38,000
INH0456hsa-miR-513a-5p InhibitorUUCACAGGGAGGUGUCAU5 nmol¥38,000
MIM0455hsa-miR-513b MimicUUCACAAGGAGGUGUCAUUUAU5 nmol¥38,000
INH0455hsa-miR-513b InhibitorUUCACAAGGAGGUGUCAUUUAU5 nmol¥38,000
MIM0457hsa-miR-513c-5p MimicUUCUCAAGGAGGUGUCGUUUAU5 nmol¥38,000
INH0457hsa-miR-513c-5p InhibitorUUCUCAAGGAGGUGUCGUUUAU5 nmol¥38,000
MIM0458hsa-miR-514a-3p MimicAUUGACACUUCUGUGAGUAGA5 nmol¥38,000
INH0458hsa-miR-514a-3p InhibitorAUUGACACUUCUGUGAGUAGA5 nmol¥38,000
MIM0459hsa-miR-515-3p MimicGAGUGCCUUCUUUUGGAGCGUU5 nmol¥38,000
INH0459hsa-miR-515-3p InhibitorGAGUGCCUUCUUUUGGAGCGUU5 nmol¥38,000
MIM0460hsa-miR-515-5p MimicUUCUCCAAAAGAAAGCACUUUCUG5 nmol¥38,000
INH0460hsa-miR-515-5p InhibitorUUCUCCAAAAGAAAGCACUUUCUG5 nmol¥38,000
MIM0462hsa-miR-516a-3p MimicUGCUUCCUUUCAGAGGGU5 nmol¥38,000
INH0462hsa-miR-516a-3p InhibitorUGCUUCCUUUCAGAGGGU5 nmol¥38,000
MIM0463hsa-miR-516a-5p MimicUUCUCGAGGAAAGAAGCACUUUC5 nmol¥38,000
INH0463hsa-miR-516a-5p InhibitorUUCUCGAGGAAAGAAGCACUUUC5 nmol¥38,000
MIM0461hsa-miR-516b-5p MimicAUCUGGAGGUAAGAAGCACUUU5 nmol¥38,000
INH0461hsa-miR-516b-5p InhibitorAUCUGGAGGUAAGAAGCACUUU5 nmol¥38,000
MIM0466hsa-miR-517-5p MimicCCUCUAGAUGGAAGCACUGUCU5 nmol¥38,000
INH0466hsa-miR-517-5p InhibitorCCUCUAGAUGGAAGCACUGUCU5 nmol¥38,000
MIM0464hsa-miR-517a-3p MimicAUCGUGCAUCCCUUUAGAGUGU5 nmol¥38,000
INH0464hsa-miR-517a-3p InhibitorAUCGUGCAUCCCUUUAGAGUGU5 nmol¥38,000
MIM0467hsa-miR-517b-3p MimicAUCGUGCAUCCCUUUAGAGUGU5 nmol¥38,000
INH0467hsa-miR-517b-3p InhibitorAUCGUGCAUCCCUUUAGAGUGU5 nmol¥38,000
MIM0465hsa-miR-517c-3p MimicAUCGUGCAUCCUUUUAGAGUGU5 nmol¥38,000
INH0465hsa-miR-517c-3p InhibitorAUCGUGCAUCCUUUUAGAGUGU5 nmol¥38,000
MIM0476hsa-miR-518a-3p MimicGAAAGCGCUUCCCUUUGCUGGA5 nmol¥38,000
INH0476hsa-miR-518a-3p InhibitorGAAAGCGCUUCCCUUUGCUGGA5 nmol¥38,000
MIM0475hsa-miR-518a-5p MimicCUGCAAAGGGAAGCCCUUUC5 nmol¥38,000
INH0475hsa-miR-518a-5p InhibitorCUGCAAAGGGAAGCCCUUUC5 nmol¥38,000
MIM0469hsa-miR-518b MimicCAAAGCGCUCCCCUUUAGAGGU5 nmol¥38,000
INH0469hsa-miR-518b InhibitorCAAAGCGCUCCCCUUUAGAGGU5 nmol¥38,000
MIM0471hsa-miR-518c-3p MimicCAAAGCGCUUCUCUUUAGAGUGU5 nmol¥38,000
INH0471hsa-miR-518c-3p InhibitorCAAAGCGCUUCUCUUUAGAGUGU5 nmol¥38,000
MIM0478hsa-miR-518c-5p MimicUCUCUGGAGGGAAGCACUUUCUG5 nmol¥38,000
INH0478hsa-miR-518c-5p InhibitorUCUCUGGAGGGAAGCACUUUCUG5 nmol¥38,000
MIM0470hsa-miR-518d-3p MimicCAAAGCGCUUCCCUUUGGAGC5 nmol¥38,000
INH0470hsa-miR-518d-3p InhibitorCAAAGCGCUUCCCUUUGGAGC5 nmol¥38,000
MIM0473hsa-miR-518d-5p MimicCUCUAGAGGGAAGCACUUUCUG5 nmol¥38,000
INH0473hsa-miR-518d-5p InhibitorCUCUAGAGGGAAGCACUUUCUG5 nmol¥38,000
MIM0468hsa-miR-518e-3p MimicAAAGCGCUUCCCUUCAGAGUG5 nmol¥38,000
INH0468hsa-miR-518e-3p InhibitorAAAGCGCUUCCCUUCAGAGUG5 nmol¥38,000
MIM0474hsa-miR-518e-5p MimicCUCUAGAGGGAAGCGCUUUCUG5 nmol¥38,000
INH0474hsa-miR-518e-5p InhibitorCUCUAGAGGGAAGCGCUUUCUG5 nmol¥38,000
MIM0477hsa-miR-518f-3p MimicGAAAGCGCUUCUCUUUAGAGG5 nmol¥38,000
INH0477hsa-miR-518f-3p InhibitorGAAAGCGCUUCUCUUUAGAGG5 nmol¥38,000
MIM0472hsa-miR-518f-5p MimicCUCUAGAGGGAAGCACUUUCUC5 nmol¥38,000
INH0472hsa-miR-518f-5p InhibitorCUCUAGAGGGAAGCACUUUCUC5 nmol¥38,000
MIM0480hsa-miR-519a-3p MimicAAAGUGCAUCCUUUUAGAGUGU5 nmol¥38,000
INH0480hsa-miR-519a-3p InhibitorAAAGUGCAUCCUUUUAGAGUGU5 nmol¥38,000
MIM0479hsa-miR-519b-3p MimicAAAGUGCAUCCUUUUAGAGGUU5 nmol¥38,000
INH0479hsa-miR-519b-3p InhibitorAAAGUGCAUCCUUUUAGAGGUU5 nmol¥38,000
MIM0481hsa-miR-519c-3p MimicAAAGUGCAUCUUUUUAGAGGAU5 nmol¥38,000
INH0481hsa-miR-519c-3p InhibitorAAAGUGCAUCUUUUUAGAGGAU5 nmol¥38,000
MIM0483hsa-miR-519d MimicCAAAGUGCCUCCCUUUAGAGUG5 nmol¥38,000
INH0483hsa-miR-519d InhibitorCAAAGUGCCUCCCUUUAGAGUG5 nmol¥38,000
MIM0482hsa-miR-519e-3p MimicAAGUGCCUCCUUUUAGAGUGUU5 nmol¥38,000
INH0482hsa-miR-519e-3p InhibitorAAGUGCCUCCUUUUAGAGUGUU5 nmol¥38,000
MIM0484hsa-miR-519e-5p MimicUUCUCCAAAAGGGAGCACUUUC5 nmol¥38,000
INH0484hsa-miR-519e-5p InhibitorUUCUCCAAAAGGGAGCACUUUC5 nmol¥38,000
MIM0485hsa-miR-520a-3p MimicAAAGUGCUUCCCUUUGGACUGU5 nmol¥38,000
INH0485hsa-miR-520a-3p InhibitorAAAGUGCUUCCCUUUGGACUGU5 nmol¥38,000
MIM0494hsa-miR-520a-5p MimicCUCCAGAGGGAAGUACUUUCU5 nmol¥38,000
INH0494hsa-miR-520a-5p InhibitorCUCCAGAGGGAAGUACUUUCU5 nmol¥38,000
MIM0486hsa-miR-520b MimicAAAGUGCUUCCUUUUAGAGGG5 nmol¥38,000
INH0486hsa-miR-520b InhibitorAAAGUGCUUCCUUUUAGAGGG5 nmol¥38,000
MIM0487hsa-miR-520c-3p MimicAAAGUGCUUCCUUUUAGAGGGU5 nmol¥38,000
INH0487hsa-miR-520c-3p InhibitorAAAGUGCUUCCUUUUAGAGGGU5 nmol¥38,000
MIM0489hsa-miR-520d-3p MimicAAAGUGCUUCUCUUUGGUGGGU5 nmol¥38,000
INH0489hsa-miR-520d-3p InhibitorAAAGUGCUUCUCUUUGGUGGGU5 nmol¥38,000
MIM0493hsa-miR-520d-5p MimicCUACAAAGGGAAGCCCUUUC5 nmol¥38,000
INH0493hsa-miR-520d-5p InhibitorCUACAAAGGGAAGCCCUUUC5 nmol¥38,000
MIM0488hsa-miR-520e MimicAAAGUGCUUCCUUUUUGAGGG5 nmol¥38,000
INH0488hsa-miR-520e InhibitorAAAGUGCUUCCUUUUUGAGGG5 nmol¥38,000
MIM0490hsa-miR-520f MimicAAGUGCUUCCUUUUAGAGGGUU5 nmol¥38,000
INH0490hsa-miR-520f InhibitorAAGUGCUUCCUUUUAGAGGGUU5 nmol¥38,000
MIM0492hsa-miR-520g MimicACAAAGUGCUUCCCUUUAGAGUGU5 nmol¥38,000
INH0492hsa-miR-520g InhibitorACAAAGUGCUUCCCUUUAGAGUGU5 nmol¥38,000
MIM0491hsa-miR-520h MimicACAAAGUGCUUCCCUUUAGAGU5 nmol¥38,000
INH0491hsa-miR-520h InhibitorACAAAGUGCUUCCCUUUAGAGU5 nmol¥38,000
MIM0495hsa-miR-521 MimicAACGCACUUCCCUUUAGAGUGU5 nmol¥38,000
INH0495hsa-miR-521 InhibitorAACGCACUUCCCUUUAGAGUGU5 nmol¥38,000
MIM0496hsa-miR-522-3p MimicAAAAUGGUUCCCUUUAGAGUGU5 nmol¥38,000
INH0496hsa-miR-522-3p InhibitorAAAAUGGUUCCCUUUAGAGUGU5 nmol¥38,000
MIM0497hsa-miR-523-3p MimicGAACGCGCUUCCCUAUAGAGGGU5 nmol¥38,000
INH0497hsa-miR-523-3p InhibitorGAACGCGCUUCCCUAUAGAGGGU5 nmol¥38,000
MIM0499hsa-miR-524-3p MimicGAAGGCGCUUCCCUUUGGAGU5 nmol¥38,000
INH0499hsa-miR-524-3p InhibitorGAAGGCGCUUCCCUUUGGAGU5 nmol¥38,000
MIM0498hsa-miR-524-5p MimicCUACAAAGGGAAGCACUUUCUC5 nmol¥38,000
INH0498hsa-miR-524-5p InhibitorCUACAAAGGGAAGCACUUUCUC5 nmol¥38,000
MIM0501hsa-miR-525-3p MimicGAAGGCGCUUCCCUUUAGAGCG5 nmol¥38,000
INH0501hsa-miR-525-3p InhibitorGAAGGCGCUUCCCUUUAGAGCG5 nmol¥38,000
MIM0500hsa-miR-525-5p MimicCUCCAGAGGGAUGCACUUUCU5 nmol¥38,000
INH0500hsa-miR-525-5p InhibitorCUCCAGAGGGAUGCACUUUCU5 nmol¥38,000
MIM0503hsa-miR-526b-3p MimicGAAAGUGCUUCCUUUUAGAGGC5 nmol¥38,000
INH0503hsa-miR-526b-3p InhibitorGAAAGUGCUUCCUUUUAGAGGC5 nmol¥38,000
MIM0502hsa-miR-526b-5p MimicCUCUUGAGGGAAGCACUUUCUGU5 nmol¥38,000
INH0502hsa-miR-526b-5p InhibitorCUCUUGAGGGAAGCACUUUCUGU5 nmol¥38,000
MIM0505hsa-miR-532-3p MimicCCUCCCACACCCAAGGCUUGCA5 nmol¥38,000
INH0505hsa-miR-532-3p InhibitorCCUCCCACACCCAAGGCUUGCA5 nmol¥38,000
MIM0504hsa-miR-532-5p MimicCAUGCCUUGAGUGUAGGACCGU5 nmol¥38,000
INH0504hsa-miR-532-5p InhibitorCAUGCCUUGAGUGUAGGACCGU5 nmol¥38,000
MIM0506hsa-miR-539-5p MimicGGAGAAAUUAUCCUUGGUGUGU5 nmol¥38,000
INH0506hsa-miR-539-5p InhibitorGGAGAAAUUAUCCUUGGUGUGU5 nmol¥38,000
MIM0508hsa-miR-541-3p MimicUGGUGGGCACAGAAUCUGGACU5 nmol¥38,000
INH0508hsa-miR-541-3p InhibitorUGGUGGGCACAGAAUCUGGACU5 nmol¥38,000
MIM0507hsa-miR-541-5p MimicAAAGGAUUCUGCUGUCGGUCCCACU5 nmol¥38,000
INH0507hsa-miR-541-5p InhibitorAAAGGAUUCUGCUGUCGGUCCCACU5 nmol¥38,000
MIM0510hsa-miR-542-3p MimicUGUGACAGAUUGAUAACUGAAA5 nmol¥38,000
INH0510hsa-miR-542-3p InhibitorUGUGACAGAUUGAUAACUGAAA5 nmol¥38,000
MIM0509hsa-miR-542-5p MimicUCGGGGAUCAUCAUGUCACGAGA5 nmol¥38,000
INH0509hsa-miR-542-5p InhibitorUCGGGGAUCAUCAUGUCACGAGA5 nmol¥38,000
MIM0511hsa-miR-543 MimicAAACAUUCGCGGUGCACUUCUU5 nmol¥38,000
INH0511hsa-miR-543 InhibitorAAACAUUCGCGGUGCACUUCUU5 nmol¥38,000
MIM0512hsa-miR-544a MimicAUUCUGCAUUUUUAGCAAGUUC5 nmol¥38,000
INH0512hsa-miR-544a InhibitorAUUCUGCAUUUUUAGCAAGUUC5 nmol¥38,000
MIM0513hsa-miR-545-3p MimicUCAGCAAACAUUUAUUGUGUGC5 nmol¥38,000
INH0513hsa-miR-545-3p InhibitorUCAGCAAACAUUUAUUGUGUGC5 nmol¥38,000
MIM0514hsa-miR-545-5p MimicUCAGUAAAUGUUUAUUAGAUGA5 nmol¥38,000
INH0514hsa-miR-545-5p InhibitorUCAGUAAAUGUUUAUUAGAUGA5 nmol¥38,000
MIM0529hsa-miR-548a-3p MimicCAAAACUGGCAAUUACUUUUGC5 nmol¥38,000
INH0529hsa-miR-548a-3p InhibitorCAAAACUGGCAAUUACUUUUGC5 nmol¥38,000
MIM0519hsa-miR-548a-5p MimicAAAAGUAAUUGCGAGUUUUACC5 nmol¥38,000
INH0519hsa-miR-548a-5p InhibitorAAAAGUAAUUGCGAGUUUUACC5 nmol¥38,000
MIM0532hsa-miR-548b-3p MimicCAAGAACCUCAGUUGCUUUUGU5 nmol¥38,000
INH0532hsa-miR-548b-3p InhibitorCAAGAACCUCAGUUGCUUUUGU5 nmol¥38,000
MIM0523hsa-miR-548b-5p MimicAAAAGUAAUUGUGGUUUUGGCC5 nmol¥38,000
INH0523hsa-miR-548b-5p InhibitorAAAAGUAAUUGUGGUUUUGGCC5 nmol¥38,000
MIM0528hsa-miR-548c-3p MimicCAAAAAUCUCAAUUACUUUUGC5 nmol¥38,000
INH0528hsa-miR-548c-3p InhibitorCAAAAAUCUCAAUUACUUUUGC5 nmol¥38,000
MIM0522hsa-miR-548c-5p MimicAAAAGUAAUUGCGGUUUUUGCC5 nmol¥38,000
INH0522hsa-miR-548c-5p InhibitorAAAAGUAAUUGCGGUUUUUGCC5 nmol¥38,000
MIM0527hsa-miR-548d-3p MimicCAAAAACCACAGUUUCUUUUGC5 nmol¥38,000
INH0527hsa-miR-548d-3p InhibitorCAAAAACCACAGUUUCUUUUGC5 nmol¥38,000
MIM0524hsa-miR-548d-5p MimicAAAAGUAAUUGUGGUUUUUGCC5 nmol¥38,000
INH0524hsa-miR-548d-5p InhibitorAAAAGUAAUUGUGGUUUUUGCC5 nmol¥38,000
MIM0515hsa-miR-548e MimicAAAAACUGAGACUACUUUUGCA5 nmol¥38,000
INH0515hsa-miR-548e InhibitorAAAAACUGAGACUACUUUUGCA5 nmol¥38,000
MIM0516hsa-miR-548f MimicAAAAACUGUAAUUACUUUU5 nmol¥38,000
INH0516hsa-miR-548f InhibitorAAAAACUGUAAUUACUUUU5 nmol¥38,000
MIM0517hsa-miR-548g-3p MimicAAAACUGUAAUUACUUUUGUAC5 nmol¥38,000
INH0517hsa-miR-548g-3p InhibitorAAAACUGUAAUUACUUUUGUAC5 nmol¥38,000
MIM0518hsa-miR-548h-5p MimicAAAAGUAAUCGCGGUUUUUGUC5 nmol¥38,000
INH0518hsa-miR-548h-5p InhibitorAAAAGUAAUCGCGGUUUUUGUC5 nmol¥38,000
MIM0520hsa-miR-548i MimicAAAAGUAAUUGCGGAUUUUGCC5 nmol¥38,000
INH0520hsa-miR-548i InhibitorAAAAGUAAUUGCGGAUUUUGCC5 nmol¥38,000
MIM0521hsa-miR-548j MimicAAAAGUAAUUGCGGUCUUUGGU5 nmol¥38,000
INH0521hsa-miR-548j InhibitorAAAAGUAAUUGCGGUCUUUGGU5 nmol¥38,000
MIM0525hsa-miR-548k MimicAAAAGUACUUGCGGAUUUUGCU5 nmol¥38,000
INH0525hsa-miR-548k InhibitorAAAAGUACUUGCGGAUUUUGCU5 nmol¥38,000
MIM0526hsa-miR-548l MimicAAAAGUAUUUGCGGGUUUUGUC5 nmol¥38,000
INH0526hsa-miR-548l InhibitorAAAAGUAUUUGCGGGUUUUGUC5 nmol¥38,000
MIM0531hsa-miR-548m MimicCAAAGGUAUUUGUGGUUUUUG5 nmol¥38,000
INH0531hsa-miR-548m InhibitorCAAAGGUAUUUGUGGUUUUUG5 nmol¥38,000
MIM0530hsa-miR-548n MimicCAAAAGUAAUUGUGGAUUUUGU5 nmol¥38,000
INH0530hsa-miR-548n InhibitorCAAAAGUAAUUGUGGAUUUUGU5 nmol¥38,000
MIM0533hsa-miR-548o-3p MimicCCAAAACUGCAGUUACUUUUGC5 nmol¥38,000
INH0533hsa-miR-548o-3p InhibitorCCAAAACUGCAGUUACUUUUGC5 nmol¥38,000
MIM0534hsa-miR-548p MimicUAGCAAAAACUGCAGUUACUUU5 nmol¥38,000
INH0534hsa-miR-548p InhibitorUAGCAAAAACUGCAGUUACUUU5 nmol¥38,000
MIM0535hsa-miR-549 MimicUGACAACUAUGGAUGAGCUCU5 nmol¥38,000
INH0535hsa-miR-549 InhibitorUGACAACUAUGGAUGAGCUCU5 nmol¥38,000
MIM0539hsa-miR-551a MimicGCGACCCACUCUUGGUUUCCA5 nmol¥38,000
INH0539hsa-miR-551a InhibitorGCGACCCACUCUUGGUUUCCA5 nmol¥38,000
MIM0540hsa-miR-551b-3p MimicGCGACCCAUACUUGGUUUCAG5 nmol¥38,000
INH0540hsa-miR-551b-3p InhibitorGCGACCCAUACUUGGUUUCAG5 nmol¥38,000
MIM0538hsa-miR-551b-5p MimicGAAAUCAAGCGUGGGUGAGACC5 nmol¥38,000
INH0538hsa-miR-551b-5p InhibitorGAAAUCAAGCGUGGGUGAGACC5 nmol¥38,000
MIM0541hsa-miR-552 MimicAACAGGUGACUGGUUAGACAA5 nmol¥38,000
INH0541hsa-miR-552 InhibitorAACAGGUGACUGGUUAGACAA5 nmol¥38,000
MIM0542hsa-miR-553 MimicAAAACGGUGAGAUUUUGUUUU5 nmol¥38,000
INH0542hsa-miR-553 InhibitorAAAACGGUGAGAUUUUGUUUU5 nmol¥38,000
MIM0543hsa-miR-554 MimicGCUAGUCCUGACUCAGCCAGU5 nmol¥38,000
INH0543hsa-miR-554 InhibitorGCUAGUCCUGACUCAGCCAGU5 nmol¥38,000
MIM0544hsa-miR-555 MimicAGGGUAAGCUGAACCUCUGAU5 nmol¥38,000
INH0544hsa-miR-555 InhibitorAGGGUAAGCUGAACCUCUGAU5 nmol¥38,000
MIM0545hsa-miR-556-3p MimicAUAUUACCAUUAGCUCAUCUUU5 nmol¥38,000
INH0545hsa-miR-556-3p InhibitorAUAUUACCAUUAGCUCAUCUUU5 nmol¥38,000
MIM0546hsa-miR-556-5p MimicGAUGAGCUCAUUGUAAUAUGAG5 nmol¥38,000
INH0546hsa-miR-556-5p InhibitorGAUGAGCUCAUUGUAAUAUGAG5 nmol¥38,000
MIM0547hsa-miR-557 MimicGUUUGCACGGGUGGGCCUUGUCU5 nmol¥38,000
INH0547hsa-miR-557 InhibitorGUUUGCACGGGUGGGCCUUGUCU5 nmol¥38,000
MIM0548hsa-miR-558 MimicUGAGCUGCUGUACCAAAAU5 nmol¥38,000
INH0548hsa-miR-558 InhibitorUGAGCUGCUGUACCAAAAU5 nmol¥38,000
MIM0549hsa-miR-559 MimicUAAAGUAAAUAUGCACCAAAA5 nmol¥38,000
INH0549hsa-miR-559 InhibitorUAAAGUAAAUAUGCACCAAAA5 nmol¥38,000
MIM0550hsa-miR-561-3p MimicCAAAGUUUAAGAUCCUUGAAGU5 nmol¥38,000
INH0550hsa-miR-561-3p InhibitorCAAAGUUUAAGAUCCUUGAAGU5 nmol¥38,000
MIM0551hsa-miR-562 MimicAAAGUAGCUGUACCAUUUGC5 nmol¥38,000
INH0551hsa-miR-562 InhibitorAAAGUAGCUGUACCAUUUGC5 nmol¥38,000
MIM0552hsa-miR-563 MimicAGGUUGACAUACGUUUCCC5 nmol¥38,000
INH0552hsa-miR-563 InhibitorAGGUUGACAUACGUUUCCC5 nmol¥38,000
MIM0553hsa-miR-564 MimicAGGCACGGUGUCAGCAGGC5 nmol¥38,000
INH0553hsa-miR-564 InhibitorAGGCACGGUGUCAGCAGGC5 nmol¥38,000
MIM0554hsa-miR-566 MimicGGGCGCCUGUGAUCCCAAC5 nmol¥38,000
INH0554hsa-miR-566 InhibitorGGGCGCCUGUGAUCCCAAC5 nmol¥38,000
MIM0555hsa-miR-567 MimicAGUAUGUUCUUCCAGGACAGAAC5 nmol¥38,000
INH0555hsa-miR-567 InhibitorAGUAUGUUCUUCCAGGACAGAAC5 nmol¥38,000
MIM0556hsa-miR-568 MimicAUGUAUAAAUGUAUACACAC5 nmol¥38,000
INH0556hsa-miR-568 InhibitorAUGUAUAAAUGUAUACACAC5 nmol¥38,000
MIM0557hsa-miR-569 MimicAGUUAAUGAAUCCUGGAAAGU5 nmol¥38,000
INH0557hsa-miR-569 InhibitorAGUUAAUGAAUCCUGGAAAGU5 nmol¥38,000
MIM0558hsa-miR-570-3p MimicCGAAAACAGCAAUUACCUUUGC5 nmol¥38,000
INH0558hsa-miR-570-3p InhibitorCGAAAACAGCAAUUACCUUUGC5 nmol¥38,000
MIM0559hsa-miR-571 MimicUGAGUUGGCCAUCUGAGUGAG5 nmol¥38,000
INH0559hsa-miR-571 InhibitorUGAGUUGGCCAUCUGAGUGAG5 nmol¥38,000
MIM0560hsa-miR-572 MimicGUCCGCUCGGCGGUGGCCCA5 nmol¥38,000
INH0560hsa-miR-572 InhibitorGUCCGCUCGGCGGUGGCCCA5 nmol¥38,000
MIM0561hsa-miR-573 MimicCUGAAGUGAUGUGUAACUGAUCAG5 nmol¥38,000
INH0561hsa-miR-573 InhibitorCUGAAGUGAUGUGUAACUGAUCAG5 nmol¥38,000
MIM0562hsa-miR-574-3p MimicCACGCUCAUGCACACACCCACA5 nmol¥38,000
INH0562hsa-miR-574-3p InhibitorCACGCUCAUGCACACACCCACA5 nmol¥38,000
MIM0563hsa-miR-574-5p MimicUGAGUGUGUGUGUGUGAGUGUGU5 nmol¥38,000
INH0563hsa-miR-574-5p InhibitorUGAGUGUGUGUGUGUGAGUGUGU5 nmol¥38,000
MIM0564hsa-miR-575 MimicGAGCCAGUUGGACAGGAGC5 nmol¥38,000
INH0564hsa-miR-575 InhibitorGAGCCAGUUGGACAGGAGC5 nmol¥38,000
MIM0565hsa-miR-576-3p MimicAAGAUGUGGAAAAAUUGGAAUC5 nmol¥38,000
INH0565hsa-miR-576-3p InhibitorAAGAUGUGGAAAAAUUGGAAUC5 nmol¥38,000
MIM0566hsa-miR-576-5p MimicAUUCUAAUUUCUCCACGUCUUU5 nmol¥38,000
INH0566hsa-miR-576-5p InhibitorAUUCUAAUUUCUCCACGUCUUU5 nmol¥38,000
MIM0567hsa-miR-577 MimicUAGAUAAAAUAUUGGUACCUG5 nmol¥38,000
INH0567hsa-miR-577 InhibitorUAGAUAAAAUAUUGGUACCUG5 nmol¥38,000
MIM0568hsa-miR-578 MimicCUUCUUGUGCUCUAGGAUUGU5 nmol¥38,000
INH0568hsa-miR-578 InhibitorCUUCUUGUGCUCUAGGAUUGU5 nmol¥38,000
MIM0569hsa-miR-579 MimicUUCAUUUGGUAUAAACCGCGAUU5 nmol¥38,000
INH0569hsa-miR-579 InhibitorUUCAUUUGGUAUAAACCGCGAUU5 nmol¥38,000
MIM0570hsa-miR-580 MimicUUGAGAAUGAUGAAUCAUUAGG5 nmol¥38,000
INH0570hsa-miR-580 InhibitorUUGAGAAUGAUGAAUCAUUAGG5 nmol¥38,000
MIM0571hsa-miR-581 MimicUCUUGUGUUCUCUAGAUCAGU5 nmol¥38,000
INH0571hsa-miR-581 InhibitorUCUUGUGUUCUCUAGAUCAGU5 nmol¥38,000
MIM0572hsa-miR-582-3p MimicUAACUGGUUGAACAACUGAACC5 nmol¥38,000
INH0572hsa-miR-582-3p InhibitorUAACUGGUUGAACAACUGAACC5 nmol¥38,000
MIM0573hsa-miR-582-5p MimicUUACAGUUGUUCAACCAGUUACU5 nmol¥38,000
INH0573hsa-miR-582-5p InhibitorUUACAGUUGUUCAACCAGUUACU5 nmol¥38,000
MIM0574hsa-miR-583 MimicCAAAGAGGAAGGUCCCAUUAC5 nmol¥38,000
INH0574hsa-miR-583 InhibitorCAAAGAGGAAGGUCCCAUUAC5 nmol¥38,000
MIM0575hsa-miR-584-5p MimicUUAUGGUUUGCCUGGGACUGAG5 nmol¥38,000
INH0575hsa-miR-584-5p InhibitorUUAUGGUUUGCCUGGGACUGAG5 nmol¥38,000
MIM0576hsa-miR-585 MimicUGGGCGUAUCUGUAUGCUA5 nmol¥38,000
INH0576hsa-miR-585 InhibitorUGGGCGUAUCUGUAUGCUA5 nmol¥38,000
MIM0577hsa-miR-586 MimicUAUGCAUUGUAUUUUUAGGUCC5 nmol¥38,000
INH0577hsa-miR-586 InhibitorUAUGCAUUGUAUUUUUAGGUCC5 nmol¥38,000
MIM0578hsa-miR-587 MimicUUUCCAUAGGUGAUGAGUCAC5 nmol¥38,000
INH0578hsa-miR-587 InhibitorUUUCCAUAGGUGAUGAGUCAC5 nmol¥38,000
MIM0579hsa-miR-588 MimicUUGGCCACAAUGGGUUAGAAC5 nmol¥38,000
INH0579hsa-miR-588 InhibitorUUGGCCACAAUGGGUUAGAAC5 nmol¥38,000
MIM0580hsa-miR-589-3p MimicUCAGAACAAAUGCCGGUUCCCAGA5 nmol¥38,000
INH0580hsa-miR-589-3p InhibitorUCAGAACAAAUGCCGGUUCCCAGA5 nmol¥38,000
MIM0581hsa-miR-589-5p MimicUGAGAACCACGUCUGCUCUGAG5 nmol¥38,000
INH0581hsa-miR-589-5p InhibitorUGAGAACCACGUCUGCUCUGAG5 nmol¥38,000
MIM0583hsa-miR-590-3p MimicUAAUUUUAUGUAUAAGCUAGU5 nmol¥38,000
INH0583hsa-miR-590-3p InhibitorUAAUUUUAUGUAUAAGCUAGU5 nmol¥38,000
MIM0582hsa-miR-590-5p MimicGAGCUUAUUCAUAAAAGUGCAG5 nmol¥38,000
INH0582hsa-miR-590-5p InhibitorGAGCUUAUUCAUAAAAGUGCAG5 nmol¥38,000
MIM0584hsa-miR-591 MimicAGACCAUGGGUUCUCAUUGU5 nmol¥38,000
INH0584hsa-miR-591 InhibitorAGACCAUGGGUUCUCAUUGU5 nmol¥38,000
MIM0585hsa-miR-592 MimicUUGUGUCAAUAUGCGAUGAUGU5 nmol¥38,000
INH0585hsa-miR-592 InhibitorUUGUGUCAAUAUGCGAUGAUGU5 nmol¥38,000
MIM0587hsa-miR-593-3p MimicUGUCUCUGCUGGGGUUUCU5 nmol¥38,000
INH0587hsa-miR-593-3p InhibitorUGUCUCUGCUGGGGUUUCU5 nmol¥38,000
MIM0586hsa-miR-593-5p MimicAGGCACCAGCCAGGCAUUGCUCAGC5 nmol¥38,000
INH0586hsa-miR-593-5p InhibitorAGGCACCAGCCAGGCAUUGCUCAGC5 nmol¥38,000
MIM0588hsa-miR-595 MimicGAAGUGUGCCGUGGUGUGUCU5 nmol¥38,000
INH0588hsa-miR-595 InhibitorGAAGUGUGCCGUGGUGUGUCU5 nmol¥38,000
MIM0589hsa-miR-596 MimicAAGCCUGCCCGGCUCCUCGGG5 nmol¥38,000
INH0589hsa-miR-596 InhibitorAAGCCUGCCCGGCUCCUCGGG5 nmol¥38,000
MIM0590hsa-miR-597 MimicUGUGUCACUCGAUGACCACUGU5 nmol¥38,000
INH0590hsa-miR-597 InhibitorUGUGUCACUCGAUGACCACUGU5 nmol¥38,000
MIM0591hsa-miR-598 MimicUACGUCAUCGUUGUCAUCGUCA5 nmol¥38,000
INH0591hsa-miR-598 InhibitorUACGUCAUCGUUGUCAUCGUCA5 nmol¥38,000
MIM0592hsa-miR-599 MimicGUUGUGUCAGUUUAUCAAAC5 nmol¥38,000
INH0592hsa-miR-599 InhibitorGUUGUGUCAGUUUAUCAAAC5 nmol¥38,000