miR-600...miR-699

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0593hsa-miR-600 MimicACUUACAGACAAGAGCCUUGCUC5 nmol¥38,000
INH0593hsa-miR-600 InhibitorACUUACAGACAAGAGCCUUGCUC5 nmol¥38,000
MIM0594hsa-miR-601 MimicUGGUCUAGGAUUGUUGGAGGAG5 nmol¥38,000
INH0594hsa-miR-601 InhibitorUGGUCUAGGAUUGUUGGAGGAG5 nmol¥38,000
MIM0595hsa-miR-602 MimicGACACGGGCGACAGCUGCGGCCC5 nmol¥38,000
INH0595hsa-miR-602 InhibitorGACACGGGCGACAGCUGCGGCCC5 nmol¥38,000
MIM0596hsa-miR-603 MimicCACACACUGCAAUUACUUUUGC5 nmol¥38,000
INH0596hsa-miR-603 InhibitorCACACACUGCAAUUACUUUUGC5 nmol¥38,000
MIM0597hsa-miR-604 MimicAGGCUGCGGAAUUCAGGAC5 nmol¥38,000
INH0597hsa-miR-604 InhibitorAGGCUGCGGAAUUCAGGAC5 nmol¥38,000
MIM0598hsa-miR-605 MimicUAAAUCCCAUGGUGCCUUCUCCU5 nmol¥38,000
INH0598hsa-miR-605 InhibitorUAAAUCCCAUGGUGCCUUCUCCU5 nmol¥38,000
MIM0599hsa-miR-606 MimicAAACUACUGAAAAUCAAAGAU5 nmol¥38,000
INH0599hsa-miR-606 InhibitorAAACUACUGAAAAUCAAAGAU5 nmol¥38,000
MIM0600hsa-miR-607 MimicGUUCAAAUCCAGAUCUAUAAC5 nmol¥38,000
INH0600hsa-miR-607 InhibitorGUUCAAAUCCAGAUCUAUAAC5 nmol¥38,000
MIM0601hsa-miR-608 MimicAGGGGUGGUGUUGGGACAGCUCCGU5 nmol¥38,000
INH0601hsa-miR-608 InhibitorAGGGGUGGUGUUGGGACAGCUCCGU5 nmol¥38,000
MIM0602hsa-miR-609 MimicAGGGUGUUUCUCUCAUCUCU5 nmol¥38,000
INH0602hsa-miR-609 InhibitorAGGGUGUUUCUCUCAUCUCU5 nmol¥38,000
MIM0603hsa-miR-610 MimicUGAGCUAAAUGUGUGCUGGGA5 nmol¥38,000
INH0603hsa-miR-610 InhibitorUGAGCUAAAUGUGUGCUGGGA5 nmol¥38,000
MIM0604hsa-miR-611 MimicGCGAGGACCCCUCGGGGUCUGAC5 nmol¥38,000
INH0604hsa-miR-611 InhibitorGCGAGGACCCCUCGGGGUCUGAC5 nmol¥38,000
MIM0605hsa-miR-612 MimicGCUGGGCAGGGCUUCUGAGCUCCUU5 nmol¥38,000
INH0605hsa-miR-612 InhibitorGCUGGGCAGGGCUUCUGAGCUCCUU5 nmol¥38,000
MIM0606hsa-miR-613 MimicAGGAAUGUUCCUUCUUUGCC5 nmol¥38,000
INH0606hsa-miR-613 InhibitorAGGAAUGUUCCUUCUUUGCC5 nmol¥38,000
MIM0607hsa-miR-614 MimicGAACGCCUGUUCUUGCCAGGUGG5 nmol¥38,000
INH0607hsa-miR-614 InhibitorGAACGCCUGUUCUUGCCAGGUGG5 nmol¥38,000
MIM0609hsa-miR-615-3p MimicUCCGAGCCUGGGUCUCCCUCUU5 nmol¥38,000
INH0609hsa-miR-615-3p InhibitorUCCGAGCCUGGGUCUCCCUCUU5 nmol¥38,000
MIM0608hsa-miR-615-5p MimicGGGGGUCCCCGGUGCUCGGAUC5 nmol¥38,000
INH0608hsa-miR-615-5p InhibitorGGGGGUCCCCGGUGCUCGGAUC5 nmol¥38,000
MIM0611hsa-miR-616-3p MimicAGUCAUUGGAGGGUUUGAGCAG5 nmol¥38,000
INH0611hsa-miR-616-3p InhibitorAGUCAUUGGAGGGUUUGAGCAG5 nmol¥38,000
MIM0610hsa-miR-616-5p MimicACUCAAAACCCUUCAGUGACUU5 nmol¥38,000
INH0610hsa-miR-616-5p InhibitorACUCAAAACCCUUCAGUGACUU5 nmol¥38,000
MIM0612hsa-miR-617 MimicAGACUUCCCAUUUGAAGGUGGC5 nmol¥38,000
INH0612hsa-miR-617 InhibitorAGACUUCCCAUUUGAAGGUGGC5 nmol¥38,000
MIM0613hsa-miR-618 MimicAAACUCUACUUGUCCUUCUGAGU5 nmol¥38,000
INH0613hsa-miR-618 InhibitorAAACUCUACUUGUCCUUCUGAGU5 nmol¥38,000
MIM0614hsa-miR-619 MimicGACCUGGACAUGUUUGUGCCCAGU5 nmol¥38,000
INH0614hsa-miR-619 InhibitorGACCUGGACAUGUUUGUGCCCAGU5 nmol¥38,000
MIM0615hsa-miR-620 MimicAUGGAGAUAGAUAUAGAAAU5 nmol¥38,000
INH0615hsa-miR-620 InhibitorAUGGAGAUAGAUAUAGAAAU5 nmol¥38,000
MIM0616hsa-miR-621 MimicGGCUAGCAACAGCGCUUACCU5 nmol¥38,000
INH0616hsa-miR-621 InhibitorGGCUAGCAACAGCGCUUACCU5 nmol¥38,000
MIM0617hsa-miR-622 MimicACAGUCUGCUGAGGUUGGAGC5 nmol¥38,000
INH0617hsa-miR-622 InhibitorACAGUCUGCUGAGGUUGGAGC5 nmol¥38,000
MIM0618hsa-miR-623 MimicAUCCCUUGCAGGGGCUGUUGGGU5 nmol¥38,000
INH0618hsa-miR-623 InhibitorAUCCCUUGCAGGGGCUGUUGGGU5 nmol¥38,000
MIM0619hsa-miR-624-3p MimicCACAAGGUAUUGGUAUUACCU5 nmol¥38,000
INH0619hsa-miR-624-3p InhibitorCACAAGGUAUUGGUAUUACCU5 nmol¥38,000
MIM0620hsa-miR-624-5p MimicUAGUACCAGUACCUUGUGUUCA5 nmol¥38,000
INH0620hsa-miR-624-5p InhibitorUAGUACCAGUACCUUGUGUUCA5 nmol¥38,000
MIM0622hsa-miR-625-3p MimicGACUAUAGAACUUUCCCCCUCA5 nmol¥38,000
INH0622hsa-miR-625-3p InhibitorGACUAUAGAACUUUCCCCCUCA5 nmol¥38,000
MIM0621hsa-miR-625-5p MimicAGGGGGAAAGUUCUAUAGUCC5 nmol¥38,000
INH0621hsa-miR-625-5p InhibitorAGGGGGAAAGUUCUAUAGUCC5 nmol¥38,000
MIM0623hsa-miR-626 MimicAGCUGUCUGAAAAUGUCUU5 nmol¥38,000
INH0623hsa-miR-626 InhibitorAGCUGUCUGAAAAUGUCUU5 nmol¥38,000
MIM0624hsa-miR-627 MimicGUGAGUCUCUAAGAAAAGAGGA5 nmol¥38,000
INH0624hsa-miR-627 InhibitorGUGAGUCUCUAAGAAAAGAGGA5 nmol¥38,000
MIM0626hsa-miR-628-3p MimicUCUAGUAAGAGUGGCAGUCGA5 nmol¥38,000
INH0626hsa-miR-628-3p InhibitorUCUAGUAAGAGUGGCAGUCGA5 nmol¥38,000
MIM0625hsa-miR-628-5p MimicAUGCUGACAUAUUUACUAGAGG5 nmol¥38,000
INH0625hsa-miR-628-5p InhibitorAUGCUGACAUAUUUACUAGAGG5 nmol¥38,000
MIM0627hsa-miR-629-3p MimicGUUCUCCCAACGUAAGCCCAGC5 nmol¥38,000
INH0627hsa-miR-629-3p InhibitorGUUCUCCCAACGUAAGCCCAGC5 nmol¥38,000
MIM0628hsa-miR-629-5p MimicUGGGUUUACGUUGGGAGAACU5 nmol¥38,000
INH0628hsa-miR-629-5p InhibitorUGGGUUUACGUUGGGAGAACU5 nmol¥38,000
MIM0629hsa-miR-630 MimicAGUAUUCUGUACCAGGGAAGGU5 nmol¥38,000
INH0629hsa-miR-630 InhibitorAGUAUUCUGUACCAGGGAAGGU5 nmol¥38,000
MIM0630hsa-miR-631 MimicAGACCUGGCCCAGACCUCAGC5 nmol¥38,000
INH0630hsa-miR-631 InhibitorAGACCUGGCCCAGACCUCAGC5 nmol¥38,000
MIM0631hsa-miR-632 MimicGUGUCUGCUUCCUGUGGGA5 nmol¥38,000
INH0631hsa-miR-632 InhibitorGUGUCUGCUUCCUGUGGGA5 nmol¥38,000
MIM0632hsa-miR-633 MimicCUAAUAGUAUCUACCACAAUAAA5 nmol¥38,000
INH0632hsa-miR-633 InhibitorCUAAUAGUAUCUACCACAAUAAA5 nmol¥38,000
MIM0633hsa-miR-634 MimicAACCAGCACCCCAACUUUGGAC5 nmol¥38,000
INH0633hsa-miR-634 InhibitorAACCAGCACCCCAACUUUGGAC5 nmol¥38,000
MIM0634hsa-miR-635 MimicACUUGGGCACUGAAACAAUGUCC5 nmol¥38,000
INH0634hsa-miR-635 InhibitorACUUGGGCACUGAAACAAUGUCC5 nmol¥38,000
MIM0635hsa-miR-636 MimicUGUGCUUGCUCGUCCCGCCCGCA5 nmol¥38,000
INH0635hsa-miR-636 InhibitorUGUGCUUGCUCGUCCCGCCCGCA5 nmol¥38,000
MIM0636hsa-miR-637 MimicACUGGGGGCUUUCGGGCUCUGCGU5 nmol¥38,000
INH0636hsa-miR-637 InhibitorACUGGGGGCUUUCGGGCUCUGCGU5 nmol¥38,000
MIM0637hsa-miR-638 MimicAGGGAUCGCGGGCGGGUGGCGGCCU5 nmol¥38,000
INH0637hsa-miR-638 InhibitorAGGGAUCGCGGGCGGGUGGCGGCCU5 nmol¥38,000
MIM0638hsa-miR-639 MimicAUCGCUGCGGUUGCGAGCGCUGU5 nmol¥38,000
INH0638hsa-miR-639 InhibitorAUCGCUGCGGUUGCGAGCGCUGU5 nmol¥38,000
MIM0639hsa-miR-640 MimicAUGAUCCAGGAACCUGCCUCU5 nmol¥38,000
INH0639hsa-miR-640 InhibitorAUGAUCCAGGAACCUGCCUCU5 nmol¥38,000
MIM0640hsa-miR-641 MimicAAAGACAUAGGAUAGAGUCACCUC5 nmol¥38,000
INH0640hsa-miR-641 InhibitorAAAGACAUAGGAUAGAGUCACCUC5 nmol¥38,000
MIM0642hsa-miR-643 MimicACUUGUAUGCUAGCUCAGGUAG5 nmol¥38,000
INH0642hsa-miR-643 InhibitorACUUGUAUGCUAGCUCAGGUAG5 nmol¥38,000
MIM0643hsa-miR-644a MimicAGUGUGGCUUUCUUAGAGC5 nmol¥38,000
INH0643hsa-miR-644a InhibitorAGUGUGGCUUUCUUAGAGC5 nmol¥38,000
MIM0644hsa-miR-645 MimicUCUAGGCUGGUACUGCUGA5 nmol¥38,000
INH0644hsa-miR-645 InhibitorUCUAGGCUGGUACUGCUGA5 nmol¥38,000
MIM0645hsa-miR-646 MimicAAGCAGCUGCCUCUGAGGC5 nmol¥38,000
INH0645hsa-miR-646 InhibitorAAGCAGCUGCCUCUGAGGC5 nmol¥38,000
MIM0646hsa-miR-647 MimicGUGGCUGCACUCACUUCCUUC5 nmol¥38,000
INH0646hsa-miR-647 InhibitorGUGGCUGCACUCACUUCCUUC5 nmol¥38,000
MIM0647hsa-miR-648 MimicAAGUGUGCAGGGCACUGGU5 nmol¥38,000
INH0647hsa-miR-648 InhibitorAAGUGUGCAGGGCACUGGU5 nmol¥38,000
MIM0648hsa-miR-649 MimicAAACCUGUGUUGUUCAAGAGUC5 nmol¥38,000
INH0648hsa-miR-649 InhibitorAAACCUGUGUUGUUCAAGAGUC5 nmol¥38,000
MIM0649hsa-miR-650 MimicAGGAGGCAGCGCUCUCAGGAC5 nmol¥38,000
INH0649hsa-miR-650 InhibitorAGGAGGCAGCGCUCUCAGGAC5 nmol¥38,000
MIM0650hsa-miR-651 MimicUUUAGGAUAAGCUUGACUUUUG5 nmol¥38,000
INH0650hsa-miR-651 InhibitorUUUAGGAUAAGCUUGACUUUUG5 nmol¥38,000
MIM0651hsa-miR-652-3p MimicAAUGGCGCCACUAGGGUUGUG5 nmol¥38,000
INH0651hsa-miR-652-3p InhibitorAAUGGCGCCACUAGGGUUGUG5 nmol¥38,000
MIM0652hsa-miR-653 MimicGUGUUGAAACAAUCUCUACUG5 nmol¥38,000
INH0652hsa-miR-653 InhibitorGUGUUGAAACAAUCUCUACUG5 nmol¥38,000
MIM0653hsa-miR-654-3p MimicUAUGUCUGCUGACCAUCACCUU5 nmol¥38,000
INH0653hsa-miR-654-3p InhibitorUAUGUCUGCUGACCAUCACCUU5 nmol¥38,000
MIM0654hsa-miR-654-5p MimicUGGUGGGCCGCAGAACAUGUGC5 nmol¥38,000
INH0654hsa-miR-654-5p InhibitorUGGUGGGCCGCAGAACAUGUGC5 nmol¥38,000
MIM0655hsa-miR-655 MimicAUAAUACAUGGUUAACCUCUUU5 nmol¥38,000
INH0655hsa-miR-655 InhibitorAUAAUACAUGGUUAACCUCUUU5 nmol¥38,000
MIM0656hsa-miR-656 MimicAAUAUUAUACAGUCAACCUCU5 nmol¥38,000
INH0656hsa-miR-656 InhibitorAAUAUUAUACAGUCAACCUCU5 nmol¥38,000
MIM0657hsa-miR-657 MimicGGCAGGUUCUCACCCUCUCUAGG5 nmol¥38,000
INH0657hsa-miR-657 InhibitorGGCAGGUUCUCACCCUCUCUAGG5 nmol¥38,000
MIM0658hsa-miR-658 MimicGGCGGAGGGAAGUAGGUCCGUUGGU5 nmol¥38,000
INH0658hsa-miR-658 InhibitorGGCGGAGGGAAGUAGGUCCGUUGGU5 nmol¥38,000
MIM0659hsa-miR-659-3p MimicCUUGGUUCAGGGAGGGUCCCCA5 nmol¥38,000
INH0659hsa-miR-659-3p InhibitorCUUGGUUCAGGGAGGGUCCCCA5 nmol¥38,000
MIM0660hsa-miR-660-5p MimicUACCCAUUGCAUAUCGGAGUUG5 nmol¥38,000
INH0660hsa-miR-660-5p InhibitorUACCCAUUGCAUAUCGGAGUUG5 nmol¥38,000
MIM0661hsa-miR-661 MimicUGCCUGGGUCUCUGGCCUGCGCGU5 nmol¥38,000
INH0661hsa-miR-661 InhibitorUGCCUGGGUCUCUGGCCUGCGCGU5 nmol¥38,000
MIM0662hsa-miR-662 MimicUCCCACGUUGUGGCCCAGCAG5 nmol¥38,000
INH0662hsa-miR-662 InhibitorUCCCACGUUGUGGCCCAGCAG5 nmol¥38,000
MIM0663hsa-miR-663a MimicAGGCGGGGCGCCGCGGGACCGC5 nmol¥38,000
INH0663hsa-miR-663a InhibitorAGGCGGGGCGCCGCGGGACCGC5 nmol¥38,000
MIM0664hsa-miR-663b MimicGGUGGCCCGGCCGUGCCUGAGG5 nmol¥38,000
INH0664hsa-miR-663b InhibitorGGUGGCCCGGCCGUGCCUGAGG5 nmol¥38,000
MIM0666hsa-miR-664-3p MimicUAUUCAUUUAUCCCCAGCCUACA5 nmol¥38,000
INH0666hsa-miR-664-3p InhibitorUAUUCAUUUAUCCCCAGCCUACA5 nmol¥38,000
MIM0665hsa-miR-664-5p MimicACUGGCUAGGGAAAAUGAUUGGAU5 nmol¥38,000
INH0665hsa-miR-664-5p InhibitorACUGGCUAGGGAAAAUGAUUGGAU5 nmol¥38,000
MIM0667hsa-miR-665 MimicACCAGGAGGCUGAGGCCCCU5 nmol¥38,000
INH0667hsa-miR-665 InhibitorACCAGGAGGCUGAGGCCCCU5 nmol¥38,000
MIM0668hsa-miR-668 MimicUGUCACUCGGCUCGGCCCACUAC5 nmol¥38,000
INH0668hsa-miR-668 InhibitorUGUCACUCGGCUCGGCCCACUAC5 nmol¥38,000
MIM0670hsa-miR-671-3p MimicUCCGGUUCUCAGGGCUCCACC5 nmol¥38,000
INH0670hsa-miR-671-3p InhibitorUCCGGUUCUCAGGGCUCCACC5 nmol¥38,000
MIM0669hsa-miR-671-5p MimicAGGAAGCCCUGGAGGGGCUGGAG5 nmol¥38,000
INH0669hsa-miR-671-5p InhibitorAGGAAGCCCUGGAGGGGCUGGAG5 nmol¥38,000
MIM0671hsa-miR-675-3p MimicCUGUAUGCCCUCACCGCUCA5 nmol¥38,000
INH0671hsa-miR-675-3p InhibitorCUGUAUGCCCUCACCGCUCA5 nmol¥38,000
MIM0672hsa-miR-675-5p MimicUGGUGCGGAGAGGGCCCACAGUG5 nmol¥38,000
INH0672hsa-miR-675-5p InhibitorUGGUGCGGAGAGGGCCCACAGUG5 nmol¥38,000