let-7

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0003hsa-let-7a-2-3p MimicCUGUACAGCCUCCUAGCUUUCC5 nmol¥38,000
INH0003hsa-let-7a-2-3p InhibitorCUGUACAGCCUCCUAGCUUUCC5 nmol¥38,000
MIM0002hsa-let-7a-3p MimicCUAUACAAUCUACUGUCUUUC5 nmol¥38,000
INH0002hsa-let-7a-3p InhibitorCUAUACAAUCUACUGUCUUUC5 nmol¥38,000
MIM0001hsa-let-7a-5p MimicUGAGGUAGUAGGUUGUAUAGUU5 nmol¥38,000
INH0001hsa-let-7a-5p InhibitorUGAGGUAGUAGGUUGUAUAGUU5 nmol¥38,000
MIM0005hsa-let-7b-3p MimicCUAUACAACCUACUGCCUUCCC5 nmol¥38,000
INH0005hsa-let-7b-3p InhibitorCUAUACAACCUACUGCCUUCCC5 nmol¥38,000
MIM0004hsa-let-7b-5p MimicUGAGGUAGUAGGUUGUGUGGUU5 nmol¥38,000
INH0004hsa-let-7b-5p InhibitorUGAGGUAGUAGGUUGUGUGGUU5 nmol¥38,000
MIM0006hsa-let-7c MimicUGAGGUAGUAGGUUGUAUGGUU5 nmol¥38,000
INH0006hsa-let-7c InhibitorUGAGGUAGUAGGUUGUAUGGUU5 nmol¥38,000
MIM0009hsa-let-7d-3p MimicCUAUACGACCUGCUGCCUUUCU5 nmol¥38,000
INH0009hsa-let-7d-3p InhibitorCUAUACGACCUGCUGCCUUUCU5 nmol¥38,000
MIM0008hsa-let-7d-5p MimicAGAGGUAGUAGGUUGCAUAGUU5 nmol¥38,000
INH0008hsa-let-7d-5p InhibitorAGAGGUAGUAGGUUGCAUAGUU5 nmol¥38,000
MIM0011hsa-let-7e-3p MimicCUAUACGGCCUCCUAGCUUUCC5 nmol¥38,000
INH0011hsa-let-7e-3p InhibitorCUAUACGGCCUCCUAGCUUUCC5 nmol¥38,000
MIM0010hsa-let-7e-5p MimicUGAGGUAGGAGGUUGUAUAGUU5 nmol¥38,000
INH0010hsa-let-7e-5p InhibitorUGAGGUAGGAGGUUGUAUAGUU5 nmol¥38,000
MIM0013hsa-let-7f-1-3p MimicCUAUACAAUCUAUUGCCUUCCC5 nmol¥38,000
INH0013hsa-let-7f-1-3p InhibitorCUAUACAAUCUAUUGCCUUCCC5 nmol¥38,000
MIM0014hsa-let-7f-2-3p MimicCUAUACAGUCUACUGUCUUUCC5 nmol¥38,000
INH0014hsa-let-7f-2-3p InhibitorCUAUACAGUCUACUGUCUUUCC5 nmol¥38,000
MIM0012hsa-let-7f-5p MimicUGAGGUAGUAGAUUGUAUAGUU5 nmol¥38,000
INH0012hsa-let-7f-5p InhibitorUGAGGUAGUAGAUUGUAUAGUU5 nmol¥38,000
MIM0016hsa-let-7g-3p MimicCUGUACAGGCCACUGCCUUGC5 nmol¥38,000
INH0016hsa-let-7g-3p InhibitorCUGUACAGGCCACUGCCUUGC5 nmol¥38,000
MIM0015hsa-let-7g-5p MimicUGAGGUAGUAGUUUGUACAGUU5 nmol¥38,000
INH0015hsa-let-7g-5p InhibitorUGAGGUAGUAGUUUGUACAGUU5 nmol¥38,000
MIM0018hsa-let-7i-3p MimicCUGCGCAAGCUACUGCCUUGCU5 nmol¥38,000
INH0018hsa-let-7i-3p InhibitorCUGCGCAAGCUACUGCCUUGCU5 nmol¥38,000
MIM0017hsa-let-7i-5p MimicUGAGGUAGUAGUUUGUGCUGUU5 nmol¥38,000
INH0017hsa-let-7i-5p InhibitorUGAGGUAGUAGUUUGUGCUGUU5 nmol¥38,000