Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

mIR-1...mIR-99

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0019 hsa-miR-1 Mimic UGGAAUGUAAAGAAGUAUGUAU 5 nmol ¥38,000
INH0019 hsa-miR-1 Inhibitor UGGAAUGUAAAGAAGUAUGUAU 5 nmol ¥38,000
MIM0020 hsa-miR-7-1-3p Mimic CAACAAAUCACAGUCUGCCAUA 5 nmol ¥38,000
INH0020 hsa-miR-7-1-3p Inhibitor CAACAAAUCACAGUCUGCCAUA 5 nmol ¥38,000
MIM0021 hsa-miR-7-2-3p Mimic CAACAAAUCCCAGUCUACCUAA 5 nmol ¥38,000
INH0021 hsa-miR-7-2-3p Inhibitor CAACAAAUCCCAGUCUACCUAA 5 nmol ¥38,000
MIM0022 hsa-miR-7-5p Mimic UGGAAGACUAGUGAUUUUGUUGU 5 nmol ¥38,000
INH0022 hsa-miR-7-5p Inhibitor UGGAAGACUAGUGAUUUUGUUGU 5 nmol ¥38,000
MIM0023 hsa-miR-9-3p Mimic AUAAAGCUAGAUAACCGAAAGU 5 nmol ¥38,000
INH0023 hsa-miR-9-3p Inhibitor AUAAAGCUAGAUAACCGAAAGU 5 nmol ¥38,000
MIM0024 hsa-miR-9-5p Mimic UCUUUGGUUAUCUAGCUGUAUGA 5 nmol ¥38,000
INH0024 hsa-miR-9-5p Inhibitor UCUUUGGUUAUCUAGCUGUAUGA 5 nmol ¥38,000
MIM0026 hsa-miR-10a-3p Mimic CAAAUUCGUAUCUAGGGGAAUA 5 nmol ¥38,000
INH0026 hsa-miR-10a-3p Inhibitor CAAAUUCGUAUCUAGGGGAAUA 5 nmol ¥38,000
MIM0028 hsa-miR-10a-5p Mimic UACCCUGUAGAUCCGAAUUUGUG 5 nmol ¥38,000
INH0028 hsa-miR-10a-5p Inhibitor UACCCUGUAGAUCCGAAUUUGUG 5 nmol ¥38,000
MIM0025 hsa-miR-10b-3p Mimic ACAGAUUCGAUUCUAGGGGAAU 5 nmol ¥38,000
INH0025 hsa-miR-10b-3p Inhibitor ACAGAUUCGAUUCUAGGGGAAU 5 nmol ¥38,000
MIM0027 hsa-miR-10b-5p Mimic UACCCUGUAGAACCGAAUUUGUG 5 nmol ¥38,000
INH0027 hsa-miR-10b-5p Inhibitor UACCCUGUAGAACCGAAUUUGUG 5 nmol ¥38,000
MIM0029 hsa-miR-15a-3p Mimic CAGGCCAUAUUGUGCUGCCUCA 5 nmol ¥38,000
INH0029 hsa-miR-15a-3p Inhibitor CAGGCCAUAUUGUGCUGCCUCA 5 nmol ¥38,000
MIM0031 hsa-miR-15a-5p Mimic UAGCAGCACAUAAUGGUUUGUG 5 nmol ¥38,000
INH0031 hsa-miR-15a-5p Inhibitor UAGCAGCACAUAAUGGUUUGUG 5 nmol ¥38,000
MIM0030 hsa-miR-15b-3p Mimic CGAAUCAUUAUUUGCUGCUCUA 5 nmol ¥38,000
INH0030 hsa-miR-15b-3p Inhibitor CGAAUCAUUAUUUGCUGCUCUA 5 nmol ¥38,000
MIM0032 hsa-miR-15b-5p Mimic UAGCAGCACAUCAUGGUUUACA 5 nmol ¥38,000
INH0032 hsa-miR-15b-5p Inhibitor UAGCAGCACAUCAUGGUUUACA 5 nmol ¥38,000
MIM0034 hsa-miR-16-1-3p Mimic CCAGUAUUAACUGUGCUGCUGA 5 nmol ¥38,000
INH0034 hsa-miR-16-1-3p Inhibitor CCAGUAUUAACUGUGCUGCUGA 5 nmol ¥38,000
MIM0033 hsa-miR-16-2-3p Mimic CCAAUAUUACUGUGCUGCUUUA 5 nmol ¥38,000
INH0033 hsa-miR-16-2-3p Inhibitor CCAAUAUUACUGUGCUGCUUUA 5 nmol ¥38,000
MIM0035 hsa-miR-16-5p Mimic UAGCAGCACGUAAAUAUUGGCG 5 nmol ¥38,000
INH0035 hsa-miR-16-5p Inhibitor UAGCAGCACGUAAAUAUUGGCG 5 nmol ¥38,000
MIM0036 hsa-miR-17-3p Mimic ACUGCAGUGAAGGCACUUGUAG 5 nmol ¥38,000
INH0036 hsa-miR-17-3p Inhibitor ACUGCAGUGAAGGCACUUGUAG 5 nmol ¥38,000
MIM0037 hsa-miR-17-5p Mimic CAAAGUGCUUACAGUGCAGGUAG 5 nmol ¥38,000
INH0037 hsa-miR-17-5p Inhibitor CAAAGUGCUUACAGUGCAGGUAG 5 nmol ¥38,000
MIM0038 hsa-miR-18a-3p Mimic ACUGCCCUAAGUGCUCCUUCUGG 5 nmol ¥38,000
INH0038 hsa-miR-18a-3p Inhibitor ACUGCCCUAAGUGCUCCUUCUGG 5 nmol ¥38,000
MIM0039 hsa-miR-18a-5p Mimic UAAGGUGCAUCUAGUGCAGAUAG 5 nmol ¥38,000
INH0039 hsa-miR-18a-5p Inhibitor UAAGGUGCAUCUAGUGCAGAUAG 5 nmol ¥38,000
MIM0041 hsa-miR-18b-3p Mimic UGCCCUAAAUGCCCCUUCUGGC 5 nmol ¥38,000
INH0041 hsa-miR-18b-3p Inhibitor UGCCCUAAAUGCCCCUUCUGGC 5 nmol ¥38,000
MIM0040 hsa-miR-18b-5p Mimic UAAGGUGCAUCUAGUGCAGUUAG 5 nmol ¥38,000
INH0040 hsa-miR-18b-5p Inhibitor UAAGGUGCAUCUAGUGCAGUUAG 5 nmol ¥38,000
MIM0046 hsa-miR-19a-3p Mimic UGUGCAAAUCUAUGCAAAACUGA 5 nmol ¥38,000
INH0046 hsa-miR-19a-3p Inhibitor UGUGCAAAUCUAUGCAAAACUGA 5 nmol ¥38,000
MIM0044 hsa-miR-19a-5p Mimic AGUUUUGCAUAGUUGCACUACA 5 nmol ¥38,000
INH0044 hsa-miR-19a-5p Inhibitor AGUUUUGCAUAGUUGCACUACA 5 nmol ¥38,000
MIM0042 hsa-miR-19b-1-5p Mimic AGUUUUGCAGGUUUGCAUCCAGC 5 nmol ¥38,000
INH0042 hsa-miR-19b-1-5p Inhibitor AGUUUUGCAGGUUUGCAUCCAGC 5 nmol ¥38,000
MIM0043 hsa-miR-19b-2-5p Mimic AGUUUUGCAGGUUUGCAUUUCA 5 nmol ¥38,000
INH0043 hsa-miR-19b-2-5p Inhibitor AGUUUUGCAGGUUUGCAUUUCA 5 nmol ¥38,000
MIM0045 hsa-miR-19b-3p Mimic UGUGCAAAUCCAUGCAAAACUGA 5 nmol ¥38,000
INH0045 hsa-miR-19b-3p Inhibitor UGUGCAAAUCCAUGCAAAACUGA 5 nmol ¥38,000
MIM0047 hsa-miR-20a-3p Mimic ACUGCAUUAUGAGCACUUAAAG 5 nmol ¥38,000
INH0047 hsa-miR-20a-3p Inhibitor ACUGCAUUAUGAGCACUUAAAG 5 nmol ¥38,000
MIM0050 hsa-miR-20a-5p Mimic UAAAGUGCUUAUAGUGCAGGUAG 5 nmol ¥38,000
INH0050 hsa-miR-20a-5p Inhibitor UAAAGUGCUUAUAGUGCAGGUAG 5 nmol ¥38,000
MIM0048 hsa-miR-20b-3p Mimic ACUGUAGUAUGGGCACUUCCAG 5 nmol ¥38,000
INH0048 hsa-miR-20b-3p Inhibitor ACUGUAGUAUGGGCACUUCCAG 5 nmol ¥38,000
MIM0049 hsa-miR-20b-5p Mimic CAAAGUGCUCAUAGUGCAGGUAG 5 nmol ¥38,000
INH0049 hsa-miR-20b-5p Inhibitor CAAAGUGCUCAUAGUGCAGGUAG 5 nmol ¥38,000
MIM0051 hsa-miR-21-3p Mimic CAACACCAGUCGAUGGGCUGU 5 nmol ¥38,000
INH0051 hsa-miR-21-3p Inhibitor CAACACCAGUCGAUGGGCUGU 5 nmol ¥38,000
MIM0052 hsa-miR-21-5p Mimic UAGCUUAUCAGACUGAUGUUGA 5 nmol ¥38,000
INH0052 hsa-miR-21-5p Inhibitor UAGCUUAUCAGACUGAUGUUGA 5 nmol ¥38,000
MIM0053 hsa-miR-22-3p Mimic AAGCUGCCAGUUGAAGAACUGU 5 nmol ¥38,000
INH0053 hsa-miR-22-3p Inhibitor AAGCUGCCAGUUGAAGAACUGU 5 nmol ¥38,000
MIM0054 hsa-miR-22-5p Mimic AGUUCUUCAGUGGCAAGCUUUA 5 nmol ¥38,000
INH0054 hsa-miR-22-5p Inhibitor AGUUCUUCAGUGGCAAGCUUUA 5 nmol ¥38,000
MIM0056 hsa-miR-23a-3p Mimic AUCACAUUGCCAGGGAUUUCC 5 nmol ¥38,000
INH0056 hsa-miR-23a-3p Inhibitor AUCACAUUGCCAGGGAUUUCC 5 nmol ¥38,000
MIM0057 hsa-miR-23a-5p Mimic GGGGUUCCUGGGGAUGGGAUUU 5 nmol ¥38,000
INH0057 hsa-miR-23a-5p Inhibitor GGGGUUCCUGGGGAUGGGAUUU 5 nmol ¥38,000
MIM0055 hsa-miR-23b-3p Mimic AUCACAUUGCCAGGGAUUACC 5 nmol ¥38,000
INH0055 hsa-miR-23b-3p Inhibitor AUCACAUUGCCAGGGAUUACC 5 nmol ¥38,000
MIM0058 hsa-miR-23b-5p Mimic UGGGUUCCUGGCAUGCUGAUUU 5 nmol ¥38,000
INH0058 hsa-miR-23b-5p Inhibitor UGGGUUCCUGGCAUGCUGAUUU 5 nmol ¥38,000
MIM0060 hsa-miR-24-1-5p Mimic UGCCUACUGAGCUGAUAUCAGU 5 nmol ¥38,000
INH0060 hsa-miR-24-1-5p Inhibitor UGCCUACUGAGCUGAUAUCAGU 5 nmol ¥38,000
MIM0059 hsa-miR-24-2-5p Mimic UGCCUACUGAGCUGAAACACAG 5 nmol ¥38,000
INH0059 hsa-miR-24-2-5p Inhibitor UGCCUACUGAGCUGAAACACAG 5 nmol ¥38,000
MIM0061 hsa-miR-24-3p Mimic UGGCUCAGUUCAGCAGGAACAG 5 nmol ¥38,000
INH0061 hsa-miR-24-3p Inhibitor UGGCUCAGUUCAGCAGGAACAG 5 nmol ¥38,000
MIM0063 hsa-miR-25-3p Mimic CAUUGCACUUGUCUCGGUCUGA 5 nmol ¥38,000
INH0063 hsa-miR-25-3p Inhibitor CAUUGCACUUGUCUCGGUCUGA 5 nmol ¥38,000
MIM0062 hsa-miR-25-5p Mimic AGGCGGAGACUUGGGCAAUUG 5 nmol ¥38,000
INH0062 hsa-miR-25-5p Inhibitor AGGCGGAGACUUGGGCAAUUG 5 nmol ¥38,000
MIM0065 hsa-miR-26a-1-3p Mimic CCUAUUCUUGGUUACUUGCACG 5 nmol ¥38,000
INH0065 hsa-miR-26a-1-3p Inhibitor CCUAUUCUUGGUUACUUGCACG 5 nmol ¥38,000
MIM0064 hsa-miR-26a-2-3p Mimic CCUAUUCUUGAUUACUUGUUUC 5 nmol ¥38,000
INH0064 hsa-miR-26a-2-3p Inhibitor CCUAUUCUUGAUUACUUGUUUC 5 nmol ¥38,000
MIM0067 hsa-miR-26a-5p Mimic UUCAAGUAAUCCAGGAUAGGCU 5 nmol ¥38,000
INH0067 hsa-miR-26a-5p Inhibitor UUCAAGUAAUCCAGGAUAGGCU 5 nmol ¥38,000
MIM0066 hsa-miR-26b-3p Mimic CCUGUUCUCCAUUACUUGGCUC 5 nmol ¥38,000
INH0066 hsa-miR-26b-3p Inhibitor CCUGUUCUCCAUUACUUGGCUC 5 nmol ¥38,000
MIM0068 hsa-miR-26b-5p Mimic UUCAAGUAAUUCAGGAUAGGU 5 nmol ¥38,000
INH0068 hsa-miR-26b-5p Inhibitor UUCAAGUAAUUCAGGAUAGGU 5 nmol ¥38,000
MIM0071 hsa-miR-27a-3p Mimic UUCACAGUGGCUAAGUUCCGC 5 nmol ¥38,000
INH0071 hsa-miR-27a-3p Inhibitor UUCACAGUGGCUAAGUUCCGC 5 nmol ¥38,000
MIM0070 hsa-miR-27a-5p Mimic AGGGCUUAGCUGCUUGUGAGCA 5 nmol ¥38,000
INH0070 hsa-miR-27a-5p Inhibitor AGGGCUUAGCUGCUUGUGAGCA 5 nmol ¥38,000
MIM0072 hsa-miR-27b-3p Mimic UUCACAGUGGCUAAGUUCUGC 5 nmol ¥38,000
INH0072 hsa-miR-27b-3p Inhibitor UUCACAGUGGCUAAGUUCUGC 5 nmol ¥38,000
MIM0069 hsa-miR-27b-5p Mimic AGAGCUUAGCUGAUUGGUGAAC 5 nmol ¥38,000
INH0069 hsa-miR-27b-5p Inhibitor AGAGCUUAGCUGAUUGGUGAAC 5 nmol ¥38,000
MIM0074 hsa-miR-28-3p Mimic CACUAGAUUGUGAGCUCCUGGA 5 nmol ¥38,000
INH0074 hsa-miR-28-3p Inhibitor CACUAGAUUGUGAGCUCCUGGA 5 nmol ¥38,000
MIM0073 hsa-miR-28-5p Mimic AAGGAGCUCACAGUCUAUUGAG 5 nmol ¥38,000
INH0073 hsa-miR-28-5p Inhibitor AAGGAGCUCACAGUCUAUUGAG 5 nmol ¥38,000
MIM0078 hsa-miR-29a-3p Mimic UAGCACCAUCUGAAAUCGGUUA 5 nmol ¥38,000
INH0078 hsa-miR-29a-3p Inhibitor UAGCACCAUCUGAAAUCGGUUA 5 nmol ¥38,000
MIM0075 hsa-miR-29a-5p Mimic ACUGAUUUCUUUUGGUGUUCAG 5 nmol ¥38,000
INH0075 hsa-miR-29a-5p Inhibitor ACUGAUUUCUUUUGGUGUUCAG 5 nmol ¥38,000
MIM0077 hsa-miR-29b-1-5p Mimic GCUGGUUUCAUAUGGUGGUUUAGA 5 nmol ¥38,000
INH0077 hsa-miR-29b-1-5p Inhibitor GCUGGUUUCAUAUGGUGGUUUAGA 5 nmol ¥38,000
MIM0076 hsa-miR-29b-2-5p Mimic CUGGUUUCACAUGGUGGCUUAG 5 nmol ¥38,000
INH0076 hsa-miR-29b-2-5p Inhibitor CUGGUUUCACAUGGUGGCUUAG 5 nmol ¥38,000
MIM0079 hsa-miR-29b-3p Mimic UAGCACCAUUUGAAAUCAGUGUU 5 nmol ¥38,000
INH0079 hsa-miR-29b-3p Inhibitor UAGCACCAUUUGAAAUCAGUGUU 5 nmol ¥38,000
MIM0080 hsa-miR-29c-3p Mimic UAGCACCAUUUGAAAUCGGUUA 5 nmol ¥38,000
INH0080 hsa-miR-29c-3p Inhibitor UAGCACCAUUUGAAAUCGGUUA 5 nmol ¥38,000
MIM0081 hsa-miR-29c-5p Mimic UGACCGAUUUCUCCUGGUGUUC 5 nmol ¥38,000
INH0081 hsa-miR-29c-5p Inhibitor UGACCGAUUUCUCCUGGUGUUC 5 nmol ¥38,000
MIM0087 hsa-miR-30a-3p Mimic CUUUCAGUCGGAUGUUUGCAGC 5 nmol ¥38,000
INH0087 hsa-miR-30a-3p Inhibitor CUUUCAGUCGGAUGUUUGCAGC 5 nmol ¥38,000
MIM0091 hsa-miR-30a-5p Mimic UGUAAACAUCCUCGACUGGAAG 5 nmol ¥38,000
INH0091 hsa-miR-30a-5p Inhibitor UGUAAACAUCCUCGACUGGAAG 5 nmol ¥38,000
MIM0084 hsa-miR-30b-3p Mimic CUGGGAGGUGGAUGUUUACUUC 5 nmol ¥38,000
INH0084 hsa-miR-30b-3p Inhibitor CUGGGAGGUGGAUGUUUACUUC 5 nmol ¥38,000
MIM0089 hsa-miR-30b-5p Mimic UGUAAACAUCCUACACUCAGCU 5 nmol ¥38,000
INH0089 hsa-miR-30b-5p Inhibitor UGUAAACAUCCUACACUCAGCU 5 nmol ¥38,000
MIM0083 hsa-miR-30c-1-3p Mimic CUGGGAGAGGGUUGUUUACUCC 5 nmol ¥38,000
INH0083 hsa-miR-30c-1-3p Inhibitor CUGGGAGAGGGUUGUUUACUCC 5 nmol ¥38,000
MIM0082 hsa-miR-30c-2-3p Mimic CUGGGAGAAGGCUGUUUACUCU 5 nmol ¥38,000
INH0082 hsa-miR-30c-2-3p Inhibitor CUGGGAGAAGGCUGUUUACUCU 5 nmol ¥38,000
MIM0090 hsa-miR-30c-5p Mimic UGUAAACAUCCUACACUCUCAGC 5 nmol ¥38,000
INH0090 hsa-miR-30c-5p Inhibitor UGUAAACAUCCUACACUCUCAGC 5 nmol ¥38,000
MIM0085 hsa-miR-30d-3p Mimic CUUUCAGUCAGAUGUUUGCUGC 5 nmol ¥38,000
INH0085 hsa-miR-30d-3p Inhibitor CUUUCAGUCAGAUGUUUGCUGC 5 nmol ¥38,000
MIM0088 hsa-miR-30d-5p Mimic UGUAAACAUCCCCGACUGGAAG 5 nmol ¥38,000
INH0088 hsa-miR-30d-5p Inhibitor UGUAAACAUCCCCGACUGGAAG 5 nmol ¥38,000
MIM0086 hsa-miR-30e-3p Mimic CUUUCAGUCGGAUGUUUACAGC 5 nmol ¥38,000
INH0086 hsa-miR-30e-3p Inhibitor CUUUCAGUCGGAUGUUUACAGC 5 nmol ¥38,000
MIM0092 hsa-miR-30e-5p Mimic UGUAAACAUCCUUGACUGGAAG 5 nmol ¥38,000
INH0092 hsa-miR-30e-5p Inhibitor UGUAAACAUCCUUGACUGGAAG 5 nmol ¥38,000
MIM0094 hsa-miR-31-3p Mimic UGCUAUGCCAACAUAUUGCCAU 5 nmol ¥38,000
INH0094 hsa-miR-31-3p Inhibitor UGCUAUGCCAACAUAUUGCCAU 5 nmol ¥38,000
MIM0093 hsa-miR-31-5p Mimic AGGCAAGAUGCUGGCAUAGCU 5 nmol ¥38,000
INH0093 hsa-miR-31-5p Inhibitor AGGCAAGAUGCUGGCAUAGCU 5 nmol ¥38,000
MIM0095 hsa-miR-32-3p Mimic CAAUUUAGUGUGUGUGAUAUUU 5 nmol ¥38,000
INH0095 hsa-miR-32-3p Inhibitor CAAUUUAGUGUGUGUGAUAUUU 5 nmol ¥38,000
MIM0096 hsa-miR-32-5p Mimic UAUUGCACAUUACUAAGUUGCA 5 nmol ¥38,000
INH0096 hsa-miR-32-5p Inhibitor UAUUGCACAUUACUAAGUUGCA 5 nmol ¥38,000
MIM0097 hsa-miR-33a-3p Mimic CAAUGUUUCCACAGUGCAUCAC 5 nmol ¥38,000
INH0097 hsa-miR-33a-3p Inhibitor CAAUGUUUCCACAGUGCAUCAC 5 nmol ¥38,000
MIM0100 hsa-miR-33a-5p Mimic GUGCAUUGUAGUUGCAUUGCA 5 nmol ¥38,000
INH0100 hsa-miR-33a-5p Inhibitor GUGCAUUGUAGUUGCAUUGCA 5 nmol ¥38,000
MIM0098 hsa-miR-33b-3p Mimic CAGUGCCUCGGCAGUGCAGCCC 5 nmol ¥38,000
INH0098 hsa-miR-33b-3p Inhibitor CAGUGCCUCGGCAGUGCAGCCC 5 nmol ¥38,000
MIM0099 hsa-miR-33b-5p Mimic GUGCAUUGCUGUUGCAUUGC 5 nmol ¥38,000
INH0099 hsa-miR-33b-5p Inhibitor GUGCAUUGCUGUUGCAUUGC 5 nmol ¥38,000
MIM0104 hsa-miR-34a-3p Mimic CAAUCAGCAAGUAUACUGCCCU 5 nmol ¥38,000
INH0104 hsa-miR-34a-3p Inhibitor CAAUCAGCAAGUAUACUGCCCU 5 nmol ¥38,000
MIM0106 hsa-miR-34a-5p Mimic UGGCAGUGUCUUAGCUGGUUGU 5 nmol ¥38,000
INH0106 hsa-miR-34a-5p Inhibitor UGGCAGUGUCUUAGCUGGUUGU 5 nmol ¥38,000
MIM0103 hsa-miR-34b-3p Mimic CAAUCACUAACUCCACUGCCAU 5 nmol ¥38,000
INH0103 hsa-miR-34b-3p Inhibitor CAAUCACUAACUCCACUGCCAU 5 nmol ¥38,000
MIM0105 hsa-miR-34b-5p Mimic UAGGCAGUGUCAUUAGCUGAUUG 5 nmol ¥38,000
INH0105 hsa-miR-34b-5p Inhibitor UAGGCAGUGUCAUUAGCUGAUUG 5 nmol ¥38,000
MIM0101 hsa-miR-34c-3p Mimic AAUCACUAACCACACGGCCAGG 5 nmol ¥38,000
INH0101 hsa-miR-34c-3p Inhibitor AAUCACUAACCACACGGCCAGG 5 nmol ¥38,000
MIM0102 hsa-miR-34c-5p Mimic AGGCAGUGUAGUUAGCUGAUUGC 5 nmol ¥38,000
INH0102 hsa-miR-34c-5p Inhibitor AGGCAGUGUAGUUAGCUGAUUGC 5 nmol ¥38,000
MIM0108 hsa-miR-92a-1-5p Mimic AGGUUGGGAUCGGUUGCAAUGCU 5 nmol ¥38,000
INH0108 hsa-miR-92a-1-5p Inhibitor AGGUUGGGAUCGGUUGCAAUGCU 5 nmol ¥38,000
MIM0109 hsa-miR-92a-2-5p Mimic GGGUGGGGAUUUGUUGCAUUAC 5 nmol ¥38,000
INH0109 hsa-miR-92a-2-5p Inhibitor GGGUGGGGAUUUGUUGCAUUAC 5 nmol ¥38,000
MIM0111 hsa-miR-92a-3p Mimic UAUUGCACUUGUCCCGGCCUGU 5 nmol ¥38,000
INH0111 hsa-miR-92a-3p Inhibitor UAUUGCACUUGUCCCGGCCUGU 5 nmol ¥38,000
MIM0110 hsa-miR-92b-3p Mimic UAUUGCACUCGUCCCGGCCUCC 5 nmol ¥38,000
INH0110 hsa-miR-92b-3p Inhibitor UAUUGCACUCGUCCCGGCCUCC 5 nmol ¥38,000
MIM0107 hsa-miR-92b-5p Mimic AGGGACGGGACGCGGUGCAGUG 5 nmol ¥38,000
INH0107 hsa-miR-92b-5p Inhibitor AGGGACGGGACGCGGUGCAGUG 5 nmol ¥38,000
MIM0112 hsa-miR-93-3p Mimic ACUGCUGAGCUAGCACUUCCCG 5 nmol ¥38,000
INH0112 hsa-miR-93-3p Inhibitor ACUGCUGAGCUAGCACUUCCCG 5 nmol ¥38,000
MIM0113 hsa-miR-93-5p Mimic CAAAGUGCUGUUCGUGCAGGUAG 5 nmol ¥38,000
INH0113 hsa-miR-93-5p Inhibitor CAAAGUGCUGUUCGUGCAGGUAG 5 nmol ¥38,000
MIM0114 hsa-miR-95 Mimic UUCAACGGGUAUUUAUUGAGCA 5 nmol ¥38,000
INH0114 hsa-miR-95 Inhibitor UUCAACGGGUAUUUAUUGAGCA 5 nmol ¥38,000
MIM0115 hsa-miR-96-3p Mimic AAUCAUGUGCAGUGCCAAUAUG 5 nmol ¥38,000
INH0115 hsa-miR-96-3p Inhibitor AAUCAUGUGCAGUGCCAAUAUG 5 nmol ¥38,000
MIM0116 hsa-miR-98 Mimic UGAGGUAGUAAGUUGUAUUGUU 5 nmol ¥38,000
INH0116 hsa-miR-98 Inhibitor UGAGGUAGUAAGUUGUAUUGUU 5 nmol ¥38,000
MIM0118 hsa-miR-99a-3p Mimic CAAGCUCGCUUCUAUGGGUCUG 5 nmol ¥38,000
INH0118 hsa-miR-99a-3p Inhibitor CAAGCUCGCUUCUAUGGGUCUG 5 nmol ¥38,000
MIM0117 hsa-miR-99a-5p Mimic AACCCGUAGAUCCGAUCUUGUG 5 nmol ¥38,000
INH0117 hsa-miR-99a-5p Inhibitor AACCCGUAGAUCCGAUCUUGUG 5 nmol ¥38,000
MIM0119 hsa-miR-99b-3p Mimic CAAGCUCGUGUCUGUGGGUCCG 5 nmol ¥38,000
INH0119 hsa-miR-99b-3p Inhibitor CAAGCUCGUGUCUGUGGGUCCG 5 nmol ¥38,000
MIM0120 hsa-miR-99b-5p Mimic CACCCGUAGAACCGACCUUGCG 5 nmol ¥38,000
INH0120 hsa-miR-99b-5p Inhibitor CACCCGUAGAACCGACCUUGCG 5 nmol ¥38,000