Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

miR-500...miR-599

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol ¥38,000
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol ¥38,000
MIM0437 hsa-miR-501-3p Mimic AAUGCACCCGGGCAAGGAUUCU 5 nmol ¥38,000
INH0437 hsa-miR-501-3p Inhibitor AAUGCACCCGGGCAAGGAUUCU 5 nmol ¥38,000
MIM0436 hsa-miR-501-5p Mimic AAUCCUUUGUCCCUGGGUGAGA 5 nmol ¥38,000
INH0436 hsa-miR-501-5p Inhibitor AAUCCUUUGUCCCUGGGUGAGA 5 nmol ¥38,000
MIM0438 hsa-miR-502-3p Mimic AAUGCACCUGGGCAAGGAUUCA 5 nmol ¥38,000
INH0438 hsa-miR-502-3p Inhibitor AAUGCACCUGGGCAAGGAUUCA 5 nmol ¥38,000
MIM0439 hsa-miR-502-5p Mimic AUCCUUGCUAUCUGGGUGCUA 5 nmol ¥38,000
INH0439 hsa-miR-502-5p Inhibitor AUCCUUGCUAUCUGGGUGCUA 5 nmol ¥38,000
MIM0440 hsa-miR-503 Mimic UAGCAGCGGGAACAGUUCUGCAG 5 nmol ¥38,000
INH0440 hsa-miR-503 Inhibitor UAGCAGCGGGAACAGUUCUGCAG 5 nmol ¥38,000
MIM0441 hsa-miR-504 Mimic AGACCCUGGUCUGCACUCUAUC 5 nmol ¥38,000
INH0441 hsa-miR-504 Inhibitor AGACCCUGGUCUGCACUCUAUC 5 nmol ¥38,000
MIM0442 hsa-miR-505-3p Mimic CGUCAACACUUGCUGGUUUCCU 5 nmol ¥38,000
INH0442 hsa-miR-505-3p Inhibitor CGUCAACACUUGCUGGUUUCCU 5 nmol ¥38,000
MIM0443 hsa-miR-505-5p Mimic GGGAGCCAGGAAGUAUUGAUGU 5 nmol ¥38,000
INH0443 hsa-miR-505-5p Inhibitor GGGAGCCAGGAAGUAUUGAUGU 5 nmol ¥38,000
MIM0444 hsa-miR-506-3p Mimic UAAGGCACCCUUCUGAGUAGA 5 nmol ¥38,000
INH0444 hsa-miR-506-3p Inhibitor UAAGGCACCCUUCUGAGUAGA 5 nmol ¥38,000
MIM0446 hsa-miR-508-3p Mimic UGAUUGUAGCCUUUUGGAGUAGA 5 nmol ¥38,000
INH0446 hsa-miR-508-3p Inhibitor UGAUUGUAGCCUUUUGGAGUAGA 5 nmol ¥38,000
MIM0445 hsa-miR-508-5p Mimic UACUCCAGAGGGCGUCACUCAUG 5 nmol ¥38,000
INH0445 hsa-miR-508-5p Inhibitor UACUCCAGAGGGCGUCACUCAUG 5 nmol ¥38,000
MIM0448 hsa-miR-509-3-5p Mimic UACUGCAGACGUGGCAAUCAUG 5 nmol ¥38,000
INH0448 hsa-miR-509-3-5p Inhibitor UACUGCAGACGUGGCAAUCAUG 5 nmol ¥38,000
MIM0449 hsa-miR-509-3p Mimic UGAUUGGUACGUCUGUGGGUAG 5 nmol ¥38,000
INH0449 hsa-miR-509-3p Inhibitor UGAUUGGUACGUCUGUGGGUAG 5 nmol ¥38,000
MIM0447 hsa-miR-509-5p Mimic UACUGCAGACAGUGGCAAUCA 5 nmol ¥38,000
INH0447 hsa-miR-509-5p Inhibitor UACUGCAGACAGUGGCAAUCA 5 nmol ¥38,000
MIM0450 hsa-miR-510 Mimic UACUCAGGAGAGUGGCAAUCAC 5 nmol ¥38,000
INH0450 hsa-miR-510 Inhibitor UACUCAGGAGAGUGGCAAUCAC 5 nmol ¥38,000
MIM0451 hsa-miR-511 Mimic GUGUCUUUUGCUCUGCAGUCA 5 nmol ¥38,000
INH0451 hsa-miR-511 Inhibitor GUGUCUUUUGCUCUGCAGUCA 5 nmol ¥38,000
MIM0452 hsa-miR-512-3p Mimic AAGUGCUGUCAUAGCUGAGGUC 5 nmol ¥38,000
INH0452 hsa-miR-512-3p Inhibitor AAGUGCUGUCAUAGCUGAGGUC 5 nmol ¥38,000
MIM0453 hsa-miR-512-5p Mimic CACUCAGCCUUGAGGGCACUUUC 5 nmol ¥38,000
INH0453 hsa-miR-512-5p Inhibitor CACUCAGCCUUGAGGGCACUUUC 5 nmol ¥38,000
MIM0454 hsa-miR-513a-3p Mimic UAAAUUUCACCUUUCUGAGAAGG 5 nmol ¥38,000
INH0454 hsa-miR-513a-3p Inhibitor UAAAUUUCACCUUUCUGAGAAGG 5 nmol ¥38,000
MIM0456 hsa-miR-513a-5p Mimic UUCACAGGGAGGUGUCAU 5 nmol ¥38,000
INH0456 hsa-miR-513a-5p Inhibitor UUCACAGGGAGGUGUCAU 5 nmol ¥38,000
MIM0455 hsa-miR-513b Mimic UUCACAAGGAGGUGUCAUUUAU 5 nmol ¥38,000
INH0455 hsa-miR-513b Inhibitor UUCACAAGGAGGUGUCAUUUAU 5 nmol ¥38,000
MIM0457 hsa-miR-513c-5p Mimic UUCUCAAGGAGGUGUCGUUUAU 5 nmol ¥38,000
INH0457 hsa-miR-513c-5p Inhibitor UUCUCAAGGAGGUGUCGUUUAU 5 nmol ¥38,000
MIM0458 hsa-miR-514a-3p Mimic AUUGACACUUCUGUGAGUAGA 5 nmol ¥38,000
INH0458 hsa-miR-514a-3p Inhibitor AUUGACACUUCUGUGAGUAGA 5 nmol ¥38,000
MIM0459 hsa-miR-515-3p Mimic GAGUGCCUUCUUUUGGAGCGUU 5 nmol ¥38,000
INH0459 hsa-miR-515-3p Inhibitor GAGUGCCUUCUUUUGGAGCGUU 5 nmol ¥38,000
MIM0460 hsa-miR-515-5p Mimic UUCUCCAAAAGAAAGCACUUUCUG 5 nmol ¥38,000
INH0460 hsa-miR-515-5p Inhibitor UUCUCCAAAAGAAAGCACUUUCUG 5 nmol ¥38,000
MIM0462 hsa-miR-516a-3p Mimic UGCUUCCUUUCAGAGGGU 5 nmol ¥38,000
INH0462 hsa-miR-516a-3p Inhibitor UGCUUCCUUUCAGAGGGU 5 nmol ¥38,000
MIM0463 hsa-miR-516a-5p Mimic UUCUCGAGGAAAGAAGCACUUUC 5 nmol ¥38,000
INH0463 hsa-miR-516a-5p Inhibitor UUCUCGAGGAAAGAAGCACUUUC 5 nmol ¥38,000
MIM0461 hsa-miR-516b-5p Mimic AUCUGGAGGUAAGAAGCACUUU 5 nmol ¥38,000
INH0461 hsa-miR-516b-5p Inhibitor AUCUGGAGGUAAGAAGCACUUU 5 nmol ¥38,000
MIM0466 hsa-miR-517-5p Mimic CCUCUAGAUGGAAGCACUGUCU 5 nmol ¥38,000
INH0466 hsa-miR-517-5p Inhibitor CCUCUAGAUGGAAGCACUGUCU 5 nmol ¥38,000
MIM0464 hsa-miR-517a-3p Mimic AUCGUGCAUCCCUUUAGAGUGU 5 nmol ¥38,000
INH0464 hsa-miR-517a-3p Inhibitor AUCGUGCAUCCCUUUAGAGUGU 5 nmol ¥38,000
MIM0467 hsa-miR-517b-3p Mimic AUCGUGCAUCCCUUUAGAGUGU 5 nmol ¥38,000
INH0467 hsa-miR-517b-3p Inhibitor AUCGUGCAUCCCUUUAGAGUGU 5 nmol ¥38,000
MIM0465 hsa-miR-517c-3p Mimic AUCGUGCAUCCUUUUAGAGUGU 5 nmol ¥38,000
INH0465 hsa-miR-517c-3p Inhibitor AUCGUGCAUCCUUUUAGAGUGU 5 nmol ¥38,000
MIM0476 hsa-miR-518a-3p Mimic GAAAGCGCUUCCCUUUGCUGGA 5 nmol ¥38,000
INH0476 hsa-miR-518a-3p Inhibitor GAAAGCGCUUCCCUUUGCUGGA 5 nmol ¥38,000
MIM0475 hsa-miR-518a-5p Mimic CUGCAAAGGGAAGCCCUUUC 5 nmol ¥38,000
INH0475 hsa-miR-518a-5p Inhibitor CUGCAAAGGGAAGCCCUUUC 5 nmol ¥38,000
MIM0469 hsa-miR-518b Mimic CAAAGCGCUCCCCUUUAGAGGU 5 nmol ¥38,000
INH0469 hsa-miR-518b Inhibitor CAAAGCGCUCCCCUUUAGAGGU 5 nmol ¥38,000
MIM0471 hsa-miR-518c-3p Mimic CAAAGCGCUUCUCUUUAGAGUGU 5 nmol ¥38,000
INH0471 hsa-miR-518c-3p Inhibitor CAAAGCGCUUCUCUUUAGAGUGU 5 nmol ¥38,000
MIM0478 hsa-miR-518c-5p Mimic UCUCUGGAGGGAAGCACUUUCUG 5 nmol ¥38,000
INH0478 hsa-miR-518c-5p Inhibitor UCUCUGGAGGGAAGCACUUUCUG 5 nmol ¥38,000
MIM0470 hsa-miR-518d-3p Mimic CAAAGCGCUUCCCUUUGGAGC 5 nmol ¥38,000
INH0470 hsa-miR-518d-3p Inhibitor CAAAGCGCUUCCCUUUGGAGC 5 nmol ¥38,000
MIM0473 hsa-miR-518d-5p Mimic CUCUAGAGGGAAGCACUUUCUG 5 nmol ¥38,000
INH0473 hsa-miR-518d-5p Inhibitor CUCUAGAGGGAAGCACUUUCUG 5 nmol ¥38,000
MIM0468 hsa-miR-518e-3p Mimic AAAGCGCUUCCCUUCAGAGUG 5 nmol ¥38,000
INH0468 hsa-miR-518e-3p Inhibitor AAAGCGCUUCCCUUCAGAGUG 5 nmol ¥38,000
MIM0474 hsa-miR-518e-5p Mimic CUCUAGAGGGAAGCGCUUUCUG 5 nmol ¥38,000
INH0474 hsa-miR-518e-5p Inhibitor CUCUAGAGGGAAGCGCUUUCUG 5 nmol ¥38,000
MIM0477 hsa-miR-518f-3p Mimic GAAAGCGCUUCUCUUUAGAGG 5 nmol ¥38,000
INH0477 hsa-miR-518f-3p Inhibitor GAAAGCGCUUCUCUUUAGAGG 5 nmol ¥38,000
MIM0472 hsa-miR-518f-5p Mimic CUCUAGAGGGAAGCACUUUCUC 5 nmol ¥38,000
INH0472 hsa-miR-518f-5p Inhibitor CUCUAGAGGGAAGCACUUUCUC 5 nmol ¥38,000
MIM0480 hsa-miR-519a-3p Mimic AAAGUGCAUCCUUUUAGAGUGU 5 nmol ¥38,000
INH0480 hsa-miR-519a-3p Inhibitor AAAGUGCAUCCUUUUAGAGUGU 5 nmol ¥38,000
MIM0479 hsa-miR-519b-3p Mimic AAAGUGCAUCCUUUUAGAGGUU 5 nmol ¥38,000
INH0479 hsa-miR-519b-3p Inhibitor AAAGUGCAUCCUUUUAGAGGUU 5 nmol ¥38,000
MIM0481 hsa-miR-519c-3p Mimic AAAGUGCAUCUUUUUAGAGGAU 5 nmol ¥38,000
INH0481 hsa-miR-519c-3p Inhibitor AAAGUGCAUCUUUUUAGAGGAU 5 nmol ¥38,000
MIM0483 hsa-miR-519d Mimic CAAAGUGCCUCCCUUUAGAGUG 5 nmol ¥38,000
INH0483 hsa-miR-519d Inhibitor CAAAGUGCCUCCCUUUAGAGUG 5 nmol ¥38,000
MIM0482 hsa-miR-519e-3p Mimic AAGUGCCUCCUUUUAGAGUGUU 5 nmol ¥38,000
INH0482 hsa-miR-519e-3p Inhibitor AAGUGCCUCCUUUUAGAGUGUU 5 nmol ¥38,000
MIM0484 hsa-miR-519e-5p Mimic UUCUCCAAAAGGGAGCACUUUC 5 nmol ¥38,000
INH0484 hsa-miR-519e-5p Inhibitor UUCUCCAAAAGGGAGCACUUUC 5 nmol ¥38,000
MIM0485 hsa-miR-520a-3p Mimic AAAGUGCUUCCCUUUGGACUGU 5 nmol ¥38,000
INH0485 hsa-miR-520a-3p Inhibitor AAAGUGCUUCCCUUUGGACUGU 5 nmol ¥38,000
MIM0494 hsa-miR-520a-5p Mimic CUCCAGAGGGAAGUACUUUCU 5 nmol ¥38,000
INH0494 hsa-miR-520a-5p Inhibitor CUCCAGAGGGAAGUACUUUCU 5 nmol ¥38,000
MIM0486 hsa-miR-520b Mimic AAAGUGCUUCCUUUUAGAGGG 5 nmol ¥38,000
INH0486 hsa-miR-520b Inhibitor AAAGUGCUUCCUUUUAGAGGG 5 nmol ¥38,000
MIM0487 hsa-miR-520c-3p Mimic AAAGUGCUUCCUUUUAGAGGGU 5 nmol ¥38,000
INH0487 hsa-miR-520c-3p Inhibitor AAAGUGCUUCCUUUUAGAGGGU 5 nmol ¥38,000
MIM0489 hsa-miR-520d-3p Mimic AAAGUGCUUCUCUUUGGUGGGU 5 nmol ¥38,000
INH0489 hsa-miR-520d-3p Inhibitor AAAGUGCUUCUCUUUGGUGGGU 5 nmol ¥38,000
MIM0493 hsa-miR-520d-5p Mimic CUACAAAGGGAAGCCCUUUC 5 nmol ¥38,000
INH0493 hsa-miR-520d-5p Inhibitor CUACAAAGGGAAGCCCUUUC 5 nmol ¥38,000
MIM0488 hsa-miR-520e Mimic AAAGUGCUUCCUUUUUGAGGG 5 nmol ¥38,000
INH0488 hsa-miR-520e Inhibitor AAAGUGCUUCCUUUUUGAGGG 5 nmol ¥38,000
MIM0490 hsa-miR-520f Mimic AAGUGCUUCCUUUUAGAGGGUU 5 nmol ¥38,000
INH0490 hsa-miR-520f Inhibitor AAGUGCUUCCUUUUAGAGGGUU 5 nmol ¥38,000
MIM0492 hsa-miR-520g Mimic ACAAAGUGCUUCCCUUUAGAGUGU 5 nmol ¥38,000
INH0492 hsa-miR-520g Inhibitor ACAAAGUGCUUCCCUUUAGAGUGU 5 nmol ¥38,000
MIM0491 hsa-miR-520h Mimic ACAAAGUGCUUCCCUUUAGAGU 5 nmol ¥38,000
INH0491 hsa-miR-520h Inhibitor ACAAAGUGCUUCCCUUUAGAGU 5 nmol ¥38,000
MIM0495 hsa-miR-521 Mimic AACGCACUUCCCUUUAGAGUGU 5 nmol ¥38,000
INH0495 hsa-miR-521 Inhibitor AACGCACUUCCCUUUAGAGUGU 5 nmol ¥38,000
MIM0496 hsa-miR-522-3p Mimic AAAAUGGUUCCCUUUAGAGUGU 5 nmol ¥38,000
INH0496 hsa-miR-522-3p Inhibitor AAAAUGGUUCCCUUUAGAGUGU 5 nmol ¥38,000
MIM0497 hsa-miR-523-3p Mimic GAACGCGCUUCCCUAUAGAGGGU 5 nmol ¥38,000
INH0497 hsa-miR-523-3p Inhibitor GAACGCGCUUCCCUAUAGAGGGU 5 nmol ¥38,000
MIM0499 hsa-miR-524-3p Mimic GAAGGCGCUUCCCUUUGGAGU 5 nmol ¥38,000
INH0499 hsa-miR-524-3p Inhibitor GAAGGCGCUUCCCUUUGGAGU 5 nmol ¥38,000
MIM0498 hsa-miR-524-5p Mimic CUACAAAGGGAAGCACUUUCUC 5 nmol ¥38,000
INH0498 hsa-miR-524-5p Inhibitor CUACAAAGGGAAGCACUUUCUC 5 nmol ¥38,000
MIM0501 hsa-miR-525-3p Mimic GAAGGCGCUUCCCUUUAGAGCG 5 nmol ¥38,000
INH0501 hsa-miR-525-3p Inhibitor GAAGGCGCUUCCCUUUAGAGCG 5 nmol ¥38,000
MIM0500 hsa-miR-525-5p Mimic CUCCAGAGGGAUGCACUUUCU 5 nmol ¥38,000
INH0500 hsa-miR-525-5p Inhibitor CUCCAGAGGGAUGCACUUUCU 5 nmol ¥38,000
MIM0503 hsa-miR-526b-3p Mimic GAAAGUGCUUCCUUUUAGAGGC 5 nmol ¥38,000
INH0503 hsa-miR-526b-3p Inhibitor GAAAGUGCUUCCUUUUAGAGGC 5 nmol ¥38,000
MIM0502 hsa-miR-526b-5p Mimic CUCUUGAGGGAAGCACUUUCUGU 5 nmol ¥38,000
INH0502 hsa-miR-526b-5p Inhibitor CUCUUGAGGGAAGCACUUUCUGU 5 nmol ¥38,000
MIM0505 hsa-miR-532-3p Mimic CCUCCCACACCCAAGGCUUGCA 5 nmol ¥38,000
INH0505 hsa-miR-532-3p Inhibitor CCUCCCACACCCAAGGCUUGCA 5 nmol ¥38,000
MIM0504 hsa-miR-532-5p Mimic CAUGCCUUGAGUGUAGGACCGU 5 nmol ¥38,000
INH0504 hsa-miR-532-5p Inhibitor CAUGCCUUGAGUGUAGGACCGU 5 nmol ¥38,000
MIM0506 hsa-miR-539-5p Mimic GGAGAAAUUAUCCUUGGUGUGU 5 nmol ¥38,000
INH0506 hsa-miR-539-5p Inhibitor GGAGAAAUUAUCCUUGGUGUGU 5 nmol ¥38,000
MIM0508 hsa-miR-541-3p Mimic UGGUGGGCACAGAAUCUGGACU 5 nmol ¥38,000
INH0508 hsa-miR-541-3p Inhibitor UGGUGGGCACAGAAUCUGGACU 5 nmol ¥38,000
MIM0507 hsa-miR-541-5p Mimic AAAGGAUUCUGCUGUCGGUCCCACU 5 nmol ¥38,000
INH0507 hsa-miR-541-5p Inhibitor AAAGGAUUCUGCUGUCGGUCCCACU 5 nmol ¥38,000
MIM0510 hsa-miR-542-3p Mimic UGUGACAGAUUGAUAACUGAAA 5 nmol ¥38,000
INH0510 hsa-miR-542-3p Inhibitor UGUGACAGAUUGAUAACUGAAA 5 nmol ¥38,000
MIM0509 hsa-miR-542-5p Mimic UCGGGGAUCAUCAUGUCACGAGA 5 nmol ¥38,000
INH0509 hsa-miR-542-5p Inhibitor UCGGGGAUCAUCAUGUCACGAGA 5 nmol ¥38,000
MIM0511 hsa-miR-543 Mimic AAACAUUCGCGGUGCACUUCUU 5 nmol ¥38,000
INH0511 hsa-miR-543 Inhibitor AAACAUUCGCGGUGCACUUCUU 5 nmol ¥38,000
MIM0512 hsa-miR-544a Mimic AUUCUGCAUUUUUAGCAAGUUC 5 nmol ¥38,000
INH0512 hsa-miR-544a Inhibitor AUUCUGCAUUUUUAGCAAGUUC 5 nmol ¥38,000
MIM0513 hsa-miR-545-3p Mimic UCAGCAAACAUUUAUUGUGUGC 5 nmol ¥38,000
INH0513 hsa-miR-545-3p Inhibitor UCAGCAAACAUUUAUUGUGUGC 5 nmol ¥38,000
MIM0514 hsa-miR-545-5p Mimic UCAGUAAAUGUUUAUUAGAUGA 5 nmol ¥38,000
INH0514 hsa-miR-545-5p Inhibitor UCAGUAAAUGUUUAUUAGAUGA 5 nmol ¥38,000
MIM0529 hsa-miR-548a-3p Mimic CAAAACUGGCAAUUACUUUUGC 5 nmol ¥38,000
INH0529 hsa-miR-548a-3p Inhibitor CAAAACUGGCAAUUACUUUUGC 5 nmol ¥38,000
MIM0519 hsa-miR-548a-5p Mimic AAAAGUAAUUGCGAGUUUUACC 5 nmol ¥38,000
INH0519 hsa-miR-548a-5p Inhibitor AAAAGUAAUUGCGAGUUUUACC 5 nmol ¥38,000
MIM0532 hsa-miR-548b-3p Mimic CAAGAACCUCAGUUGCUUUUGU 5 nmol ¥38,000
INH0532 hsa-miR-548b-3p Inhibitor CAAGAACCUCAGUUGCUUUUGU 5 nmol ¥38,000
MIM0523 hsa-miR-548b-5p Mimic AAAAGUAAUUGUGGUUUUGGCC 5 nmol ¥38,000
INH0523 hsa-miR-548b-5p Inhibitor AAAAGUAAUUGUGGUUUUGGCC 5 nmol ¥38,000
MIM0528 hsa-miR-548c-3p Mimic CAAAAAUCUCAAUUACUUUUGC 5 nmol ¥38,000
INH0528 hsa-miR-548c-3p Inhibitor CAAAAAUCUCAAUUACUUUUGC 5 nmol ¥38,000
MIM0522 hsa-miR-548c-5p Mimic AAAAGUAAUUGCGGUUUUUGCC 5 nmol ¥38,000
INH0522 hsa-miR-548c-5p Inhibitor AAAAGUAAUUGCGGUUUUUGCC 5 nmol ¥38,000
MIM0527 hsa-miR-548d-3p Mimic CAAAAACCACAGUUUCUUUUGC 5 nmol ¥38,000
INH0527 hsa-miR-548d-3p Inhibitor CAAAAACCACAGUUUCUUUUGC 5 nmol ¥38,000
MIM0524 hsa-miR-548d-5p Mimic AAAAGUAAUUGUGGUUUUUGCC 5 nmol ¥38,000
INH0524 hsa-miR-548d-5p Inhibitor AAAAGUAAUUGUGGUUUUUGCC 5 nmol ¥38,000
MIM0515 hsa-miR-548e Mimic AAAAACUGAGACUACUUUUGCA 5 nmol ¥38,000
INH0515 hsa-miR-548e Inhibitor AAAAACUGAGACUACUUUUGCA 5 nmol ¥38,000
MIM0516 hsa-miR-548f Mimic AAAAACUGUAAUUACUUUU 5 nmol ¥38,000
INH0516 hsa-miR-548f Inhibitor AAAAACUGUAAUUACUUUU 5 nmol ¥38,000
MIM0517 hsa-miR-548g-3p Mimic AAAACUGUAAUUACUUUUGUAC 5 nmol ¥38,000
INH0517 hsa-miR-548g-3p Inhibitor AAAACUGUAAUUACUUUUGUAC 5 nmol ¥38,000
MIM0518 hsa-miR-548h-5p Mimic AAAAGUAAUCGCGGUUUUUGUC 5 nmol ¥38,000
INH0518 hsa-miR-548h-5p Inhibitor AAAAGUAAUCGCGGUUUUUGUC 5 nmol ¥38,000
MIM0520 hsa-miR-548i Mimic AAAAGUAAUUGCGGAUUUUGCC 5 nmol ¥38,000
INH0520 hsa-miR-548i Inhibitor AAAAGUAAUUGCGGAUUUUGCC 5 nmol ¥38,000
MIM0521 hsa-miR-548j Mimic AAAAGUAAUUGCGGUCUUUGGU 5 nmol ¥38,000
INH0521 hsa-miR-548j Inhibitor AAAAGUAAUUGCGGUCUUUGGU 5 nmol ¥38,000
MIM0525 hsa-miR-548k Mimic AAAAGUACUUGCGGAUUUUGCU 5 nmol ¥38,000
INH0525 hsa-miR-548k Inhibitor AAAAGUACUUGCGGAUUUUGCU 5 nmol ¥38,000
MIM0526 hsa-miR-548l Mimic AAAAGUAUUUGCGGGUUUUGUC 5 nmol ¥38,000
INH0526 hsa-miR-548l Inhibitor AAAAGUAUUUGCGGGUUUUGUC 5 nmol ¥38,000
MIM0531 hsa-miR-548m Mimic CAAAGGUAUUUGUGGUUUUUG 5 nmol ¥38,000
INH0531 hsa-miR-548m Inhibitor CAAAGGUAUUUGUGGUUUUUG 5 nmol ¥38,000
MIM0530 hsa-miR-548n Mimic CAAAAGUAAUUGUGGAUUUUGU 5 nmol ¥38,000
INH0530 hsa-miR-548n Inhibitor CAAAAGUAAUUGUGGAUUUUGU 5 nmol ¥38,000
MIM0533 hsa-miR-548o-3p Mimic CCAAAACUGCAGUUACUUUUGC 5 nmol ¥38,000
INH0533 hsa-miR-548o-3p Inhibitor CCAAAACUGCAGUUACUUUUGC 5 nmol ¥38,000
MIM0534 hsa-miR-548p Mimic UAGCAAAAACUGCAGUUACUUU 5 nmol ¥38,000
INH0534 hsa-miR-548p Inhibitor UAGCAAAAACUGCAGUUACUUU 5 nmol ¥38,000
MIM0535 hsa-miR-549 Mimic UGACAACUAUGGAUGAGCUCU 5 nmol ¥38,000
INH0535 hsa-miR-549 Inhibitor UGACAACUAUGGAUGAGCUCU 5 nmol ¥38,000
MIM0539 hsa-miR-551a Mimic GCGACCCACUCUUGGUUUCCA 5 nmol ¥38,000
INH0539 hsa-miR-551a Inhibitor GCGACCCACUCUUGGUUUCCA 5 nmol ¥38,000
MIM0540 hsa-miR-551b-3p Mimic GCGACCCAUACUUGGUUUCAG 5 nmol ¥38,000
INH0540 hsa-miR-551b-3p Inhibitor GCGACCCAUACUUGGUUUCAG 5 nmol ¥38,000
MIM0538 hsa-miR-551b-5p Mimic GAAAUCAAGCGUGGGUGAGACC 5 nmol ¥38,000
INH0538 hsa-miR-551b-5p Inhibitor GAAAUCAAGCGUGGGUGAGACC 5 nmol ¥38,000
MIM0541 hsa-miR-552 Mimic AACAGGUGACUGGUUAGACAA 5 nmol ¥38,000
INH0541 hsa-miR-552 Inhibitor AACAGGUGACUGGUUAGACAA 5 nmol ¥38,000
MIM0542 hsa-miR-553 Mimic AAAACGGUGAGAUUUUGUUUU 5 nmol ¥38,000
INH0542 hsa-miR-553 Inhibitor AAAACGGUGAGAUUUUGUUUU 5 nmol ¥38,000
MIM0543 hsa-miR-554 Mimic GCUAGUCCUGACUCAGCCAGU 5 nmol ¥38,000
INH0543 hsa-miR-554 Inhibitor GCUAGUCCUGACUCAGCCAGU 5 nmol ¥38,000
MIM0544 hsa-miR-555 Mimic AGGGUAAGCUGAACCUCUGAU 5 nmol ¥38,000
INH0544 hsa-miR-555 Inhibitor AGGGUAAGCUGAACCUCUGAU 5 nmol ¥38,000
MIM0545 hsa-miR-556-3p Mimic AUAUUACCAUUAGCUCAUCUUU 5 nmol ¥38,000
INH0545 hsa-miR-556-3p Inhibitor AUAUUACCAUUAGCUCAUCUUU 5 nmol ¥38,000
MIM0546 hsa-miR-556-5p Mimic GAUGAGCUCAUUGUAAUAUGAG 5 nmol ¥38,000
INH0546 hsa-miR-556-5p Inhibitor GAUGAGCUCAUUGUAAUAUGAG 5 nmol ¥38,000
MIM0547 hsa-miR-557 Mimic GUUUGCACGGGUGGGCCUUGUCU 5 nmol ¥38,000
INH0547 hsa-miR-557 Inhibitor GUUUGCACGGGUGGGCCUUGUCU 5 nmol ¥38,000
MIM0548 hsa-miR-558 Mimic UGAGCUGCUGUACCAAAAU 5 nmol ¥38,000
INH0548 hsa-miR-558 Inhibitor UGAGCUGCUGUACCAAAAU 5 nmol ¥38,000
MIM0549 hsa-miR-559 Mimic UAAAGUAAAUAUGCACCAAAA 5 nmol ¥38,000
INH0549 hsa-miR-559 Inhibitor UAAAGUAAAUAUGCACCAAAA 5 nmol ¥38,000
MIM0550 hsa-miR-561-3p Mimic CAAAGUUUAAGAUCCUUGAAGU 5 nmol ¥38,000
INH0550 hsa-miR-561-3p Inhibitor CAAAGUUUAAGAUCCUUGAAGU 5 nmol ¥38,000
MIM0551 hsa-miR-562 Mimic AAAGUAGCUGUACCAUUUGC 5 nmol ¥38,000
INH0551 hsa-miR-562 Inhibitor AAAGUAGCUGUACCAUUUGC 5 nmol ¥38,000
MIM0552 hsa-miR-563 Mimic AGGUUGACAUACGUUUCCC 5 nmol ¥38,000
INH0552 hsa-miR-563 Inhibitor AGGUUGACAUACGUUUCCC 5 nmol ¥38,000
MIM0553 hsa-miR-564 Mimic AGGCACGGUGUCAGCAGGC 5 nmol ¥38,000
INH0553 hsa-miR-564 Inhibitor AGGCACGGUGUCAGCAGGC 5 nmol ¥38,000
MIM0554 hsa-miR-566 Mimic GGGCGCCUGUGAUCCCAAC 5 nmol ¥38,000
INH0554 hsa-miR-566 Inhibitor GGGCGCCUGUGAUCCCAAC 5 nmol ¥38,000
MIM0555 hsa-miR-567 Mimic AGUAUGUUCUUCCAGGACAGAAC 5 nmol ¥38,000
INH0555 hsa-miR-567 Inhibitor AGUAUGUUCUUCCAGGACAGAAC 5 nmol ¥38,000
MIM0556 hsa-miR-568 Mimic AUGUAUAAAUGUAUACACAC 5 nmol ¥38,000
INH0556 hsa-miR-568 Inhibitor AUGUAUAAAUGUAUACACAC 5 nmol ¥38,000
MIM0557 hsa-miR-569 Mimic AGUUAAUGAAUCCUGGAAAGU 5 nmol ¥38,000
INH0557 hsa-miR-569 Inhibitor AGUUAAUGAAUCCUGGAAAGU 5 nmol ¥38,000
MIM0558 hsa-miR-570-3p Mimic CGAAAACAGCAAUUACCUUUGC 5 nmol ¥38,000
INH0558 hsa-miR-570-3p Inhibitor CGAAAACAGCAAUUACCUUUGC 5 nmol ¥38,000
MIM0559 hsa-miR-571 Mimic UGAGUUGGCCAUCUGAGUGAG 5 nmol ¥38,000
INH0559 hsa-miR-571 Inhibitor UGAGUUGGCCAUCUGAGUGAG 5 nmol ¥38,000
MIM0560 hsa-miR-572 Mimic GUCCGCUCGGCGGUGGCCCA 5 nmol ¥38,000
INH0560 hsa-miR-572 Inhibitor GUCCGCUCGGCGGUGGCCCA 5 nmol ¥38,000
MIM0561 hsa-miR-573 Mimic CUGAAGUGAUGUGUAACUGAUCAG 5 nmol ¥38,000
INH0561 hsa-miR-573 Inhibitor CUGAAGUGAUGUGUAACUGAUCAG 5 nmol ¥38,000
MIM0562 hsa-miR-574-3p Mimic CACGCUCAUGCACACACCCACA 5 nmol ¥38,000
INH0562 hsa-miR-574-3p Inhibitor CACGCUCAUGCACACACCCACA 5 nmol ¥38,000
MIM0563 hsa-miR-574-5p Mimic UGAGUGUGUGUGUGUGAGUGUGU 5 nmol ¥38,000
INH0563 hsa-miR-574-5p Inhibitor UGAGUGUGUGUGUGUGAGUGUGU 5 nmol ¥38,000
MIM0564 hsa-miR-575 Mimic GAGCCAGUUGGACAGGAGC 5 nmol ¥38,000
INH0564 hsa-miR-575 Inhibitor GAGCCAGUUGGACAGGAGC 5 nmol ¥38,000
MIM0565 hsa-miR-576-3p Mimic AAGAUGUGGAAAAAUUGGAAUC 5 nmol ¥38,000
INH0565 hsa-miR-576-3p Inhibitor AAGAUGUGGAAAAAUUGGAAUC 5 nmol ¥38,000
MIM0566 hsa-miR-576-5p Mimic AUUCUAAUUUCUCCACGUCUUU 5 nmol ¥38,000
INH0566 hsa-miR-576-5p Inhibitor AUUCUAAUUUCUCCACGUCUUU 5 nmol ¥38,000
MIM0567 hsa-miR-577 Mimic UAGAUAAAAUAUUGGUACCUG 5 nmol ¥38,000
INH0567 hsa-miR-577 Inhibitor UAGAUAAAAUAUUGGUACCUG 5 nmol ¥38,000
MIM0568 hsa-miR-578 Mimic CUUCUUGUGCUCUAGGAUUGU 5 nmol ¥38,000
INH0568 hsa-miR-578 Inhibitor CUUCUUGUGCUCUAGGAUUGU 5 nmol ¥38,000
MIM0569 hsa-miR-579 Mimic UUCAUUUGGUAUAAACCGCGAUU 5 nmol ¥38,000
INH0569 hsa-miR-579 Inhibitor UUCAUUUGGUAUAAACCGCGAUU 5 nmol ¥38,000
MIM0570 hsa-miR-580 Mimic UUGAGAAUGAUGAAUCAUUAGG 5 nmol ¥38,000
INH0570 hsa-miR-580 Inhibitor UUGAGAAUGAUGAAUCAUUAGG 5 nmol ¥38,000
MIM0571 hsa-miR-581 Mimic UCUUGUGUUCUCUAGAUCAGU 5 nmol ¥38,000
INH0571 hsa-miR-581 Inhibitor UCUUGUGUUCUCUAGAUCAGU 5 nmol ¥38,000
MIM0572 hsa-miR-582-3p Mimic UAACUGGUUGAACAACUGAACC 5 nmol ¥38,000
INH0572 hsa-miR-582-3p Inhibitor UAACUGGUUGAACAACUGAACC 5 nmol ¥38,000
MIM0573 hsa-miR-582-5p Mimic UUACAGUUGUUCAACCAGUUACU 5 nmol ¥38,000
INH0573 hsa-miR-582-5p Inhibitor UUACAGUUGUUCAACCAGUUACU 5 nmol ¥38,000
MIM0574 hsa-miR-583 Mimic CAAAGAGGAAGGUCCCAUUAC 5 nmol ¥38,000
INH0574 hsa-miR-583 Inhibitor CAAAGAGGAAGGUCCCAUUAC 5 nmol ¥38,000
MIM0575 hsa-miR-584-5p Mimic UUAUGGUUUGCCUGGGACUGAG 5 nmol ¥38,000
INH0575 hsa-miR-584-5p Inhibitor UUAUGGUUUGCCUGGGACUGAG 5 nmol ¥38,000
MIM0576 hsa-miR-585 Mimic UGGGCGUAUCUGUAUGCUA 5 nmol ¥38,000
INH0576 hsa-miR-585 Inhibitor UGGGCGUAUCUGUAUGCUA 5 nmol ¥38,000
MIM0577 hsa-miR-586 Mimic UAUGCAUUGUAUUUUUAGGUCC 5 nmol ¥38,000
INH0577 hsa-miR-586 Inhibitor UAUGCAUUGUAUUUUUAGGUCC 5 nmol ¥38,000
MIM0578 hsa-miR-587 Mimic UUUCCAUAGGUGAUGAGUCAC 5 nmol ¥38,000
INH0578 hsa-miR-587 Inhibitor UUUCCAUAGGUGAUGAGUCAC 5 nmol ¥38,000
MIM0579 hsa-miR-588 Mimic UUGGCCACAAUGGGUUAGAAC 5 nmol ¥38,000
INH0579 hsa-miR-588 Inhibitor UUGGCCACAAUGGGUUAGAAC 5 nmol ¥38,000
MIM0580 hsa-miR-589-3p Mimic UCAGAACAAAUGCCGGUUCCCAGA 5 nmol ¥38,000
INH0580 hsa-miR-589-3p Inhibitor UCAGAACAAAUGCCGGUUCCCAGA 5 nmol ¥38,000
MIM0581 hsa-miR-589-5p Mimic UGAGAACCACGUCUGCUCUGAG 5 nmol ¥38,000
INH0581 hsa-miR-589-5p Inhibitor UGAGAACCACGUCUGCUCUGAG 5 nmol ¥38,000
MIM0583 hsa-miR-590-3p Mimic UAAUUUUAUGUAUAAGCUAGU 5 nmol ¥38,000
INH0583 hsa-miR-590-3p Inhibitor UAAUUUUAUGUAUAAGCUAGU 5 nmol ¥38,000
MIM0582 hsa-miR-590-5p Mimic GAGCUUAUUCAUAAAAGUGCAG 5 nmol ¥38,000
INH0582 hsa-miR-590-5p Inhibitor GAGCUUAUUCAUAAAAGUGCAG 5 nmol ¥38,000
MIM0584 hsa-miR-591 Mimic AGACCAUGGGUUCUCAUUGU 5 nmol ¥38,000
INH0584 hsa-miR-591 Inhibitor AGACCAUGGGUUCUCAUUGU 5 nmol ¥38,000
MIM0585 hsa-miR-592 Mimic UUGUGUCAAUAUGCGAUGAUGU 5 nmol ¥38,000
INH0585 hsa-miR-592 Inhibitor UUGUGUCAAUAUGCGAUGAUGU 5 nmol ¥38,000
MIM0587 hsa-miR-593-3p Mimic UGUCUCUGCUGGGGUUUCU 5 nmol ¥38,000
INH0587 hsa-miR-593-3p Inhibitor UGUCUCUGCUGGGGUUUCU 5 nmol ¥38,000
MIM0586 hsa-miR-593-5p Mimic AGGCACCAGCCAGGCAUUGCUCAGC 5 nmol ¥38,000
INH0586 hsa-miR-593-5p Inhibitor AGGCACCAGCCAGGCAUUGCUCAGC 5 nmol ¥38,000
MIM0588 hsa-miR-595 Mimic GAAGUGUGCCGUGGUGUGUCU 5 nmol ¥38,000
INH0588 hsa-miR-595 Inhibitor GAAGUGUGCCGUGGUGUGUCU 5 nmol ¥38,000
MIM0589 hsa-miR-596 Mimic AAGCCUGCCCGGCUCCUCGGG 5 nmol ¥38,000
INH0589 hsa-miR-596 Inhibitor AAGCCUGCCCGGCUCCUCGGG 5 nmol ¥38,000
MIM0590 hsa-miR-597 Mimic UGUGUCACUCGAUGACCACUGU 5 nmol ¥38,000
INH0590 hsa-miR-597 Inhibitor UGUGUCACUCGAUGACCACUGU 5 nmol ¥38,000
MIM0591 hsa-miR-598 Mimic UACGUCAUCGUUGUCAUCGUCA 5 nmol ¥38,000
INH0591 hsa-miR-598 Inhibitor UACGUCAUCGUUGUCAUCGUCA 5 nmol ¥38,000
MIM0592 hsa-miR-599 Mimic GUUGUGUCAGUUUAUCAAAC 5 nmol ¥38,000
INH0592 hsa-miR-599 Inhibitor GUUGUGUCAGUUUAUCAAAC 5 nmol ¥38,000