mIR-1...mIR-99

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0019hsa-miR-1 MimicUGGAAUGUAAAGAAGUAUGUAU5 nmol¥38,000
INH0019hsa-miR-1 InhibitorUGGAAUGUAAAGAAGUAUGUAU5 nmol¥38,000
MIM0020hsa-miR-7-1-3p MimicCAACAAAUCACAGUCUGCCAUA5 nmol¥38,000
INH0020hsa-miR-7-1-3p InhibitorCAACAAAUCACAGUCUGCCAUA5 nmol¥38,000
MIM0021hsa-miR-7-2-3p MimicCAACAAAUCCCAGUCUACCUAA5 nmol¥38,000
INH0021hsa-miR-7-2-3p InhibitorCAACAAAUCCCAGUCUACCUAA5 nmol¥38,000
MIM0022hsa-miR-7-5p MimicUGGAAGACUAGUGAUUUUGUUGU5 nmol¥38,000
INH0022hsa-miR-7-5p InhibitorUGGAAGACUAGUGAUUUUGUUGU5 nmol¥38,000
MIM0023hsa-miR-9-3p MimicAUAAAGCUAGAUAACCGAAAGU5 nmol¥38,000
INH0023hsa-miR-9-3p InhibitorAUAAAGCUAGAUAACCGAAAGU5 nmol¥38,000
MIM0024hsa-miR-9-5p MimicUCUUUGGUUAUCUAGCUGUAUGA5 nmol¥38,000
INH0024hsa-miR-9-5p InhibitorUCUUUGGUUAUCUAGCUGUAUGA5 nmol¥38,000
MIM0026hsa-miR-10a-3p MimicCAAAUUCGUAUCUAGGGGAAUA5 nmol¥38,000
INH0026hsa-miR-10a-3p InhibitorCAAAUUCGUAUCUAGGGGAAUA5 nmol¥38,000
MIM0028hsa-miR-10a-5p MimicUACCCUGUAGAUCCGAAUUUGUG5 nmol¥38,000
INH0028hsa-miR-10a-5p InhibitorUACCCUGUAGAUCCGAAUUUGUG5 nmol¥38,000
MIM0025hsa-miR-10b-3p MimicACAGAUUCGAUUCUAGGGGAAU5 nmol¥38,000
INH0025hsa-miR-10b-3p InhibitorACAGAUUCGAUUCUAGGGGAAU5 nmol¥38,000
MIM0027hsa-miR-10b-5p MimicUACCCUGUAGAACCGAAUUUGUG5 nmol¥38,000
INH0027hsa-miR-10b-5p InhibitorUACCCUGUAGAACCGAAUUUGUG5 nmol¥38,000
MIM0029hsa-miR-15a-3p MimicCAGGCCAUAUUGUGCUGCCUCA5 nmol¥38,000
INH0029hsa-miR-15a-3p InhibitorCAGGCCAUAUUGUGCUGCCUCA5 nmol¥38,000
MIM0031hsa-miR-15a-5p MimicUAGCAGCACAUAAUGGUUUGUG5 nmol¥38,000
INH0031hsa-miR-15a-5p InhibitorUAGCAGCACAUAAUGGUUUGUG5 nmol¥38,000
MIM0030hsa-miR-15b-3p MimicCGAAUCAUUAUUUGCUGCUCUA5 nmol¥38,000
INH0030hsa-miR-15b-3p InhibitorCGAAUCAUUAUUUGCUGCUCUA5 nmol¥38,000
MIM0032hsa-miR-15b-5p MimicUAGCAGCACAUCAUGGUUUACA5 nmol¥38,000
INH0032hsa-miR-15b-5p InhibitorUAGCAGCACAUCAUGGUUUACA5 nmol¥38,000
MIM0034hsa-miR-16-1-3p MimicCCAGUAUUAACUGUGCUGCUGA5 nmol¥38,000
INH0034hsa-miR-16-1-3p InhibitorCCAGUAUUAACUGUGCUGCUGA5 nmol¥38,000
MIM0033hsa-miR-16-2-3p MimicCCAAUAUUACUGUGCUGCUUUA5 nmol¥38,000
INH0033hsa-miR-16-2-3p InhibitorCCAAUAUUACUGUGCUGCUUUA5 nmol¥38,000
MIM0035hsa-miR-16-5p MimicUAGCAGCACGUAAAUAUUGGCG5 nmol¥38,000
INH0035hsa-miR-16-5p InhibitorUAGCAGCACGUAAAUAUUGGCG5 nmol¥38,000
MIM0036hsa-miR-17-3p MimicACUGCAGUGAAGGCACUUGUAG5 nmol¥38,000
INH0036hsa-miR-17-3p InhibitorACUGCAGUGAAGGCACUUGUAG5 nmol¥38,000
MIM0037hsa-miR-17-5p MimicCAAAGUGCUUACAGUGCAGGUAG5 nmol¥38,000
INH0037hsa-miR-17-5p InhibitorCAAAGUGCUUACAGUGCAGGUAG5 nmol¥38,000
MIM0038hsa-miR-18a-3p MimicACUGCCCUAAGUGCUCCUUCUGG5 nmol¥38,000
INH0038hsa-miR-18a-3p InhibitorACUGCCCUAAGUGCUCCUUCUGG5 nmol¥38,000
MIM0039hsa-miR-18a-5p MimicUAAGGUGCAUCUAGUGCAGAUAG5 nmol¥38,000
INH0039hsa-miR-18a-5p InhibitorUAAGGUGCAUCUAGUGCAGAUAG5 nmol¥38,000
MIM0041hsa-miR-18b-3p MimicUGCCCUAAAUGCCCCUUCUGGC5 nmol¥38,000
INH0041hsa-miR-18b-3p InhibitorUGCCCUAAAUGCCCCUUCUGGC5 nmol¥38,000
MIM0040hsa-miR-18b-5p MimicUAAGGUGCAUCUAGUGCAGUUAG5 nmol¥38,000
INH0040hsa-miR-18b-5p InhibitorUAAGGUGCAUCUAGUGCAGUUAG5 nmol¥38,000
MIM0046hsa-miR-19a-3p MimicUGUGCAAAUCUAUGCAAAACUGA5 nmol¥38,000
INH0046hsa-miR-19a-3p InhibitorUGUGCAAAUCUAUGCAAAACUGA5 nmol¥38,000
MIM0044hsa-miR-19a-5p MimicAGUUUUGCAUAGUUGCACUACA5 nmol¥38,000
INH0044hsa-miR-19a-5p InhibitorAGUUUUGCAUAGUUGCACUACA5 nmol¥38,000
MIM0042hsa-miR-19b-1-5p MimicAGUUUUGCAGGUUUGCAUCCAGC5 nmol¥38,000
INH0042hsa-miR-19b-1-5p InhibitorAGUUUUGCAGGUUUGCAUCCAGC5 nmol¥38,000
MIM0043hsa-miR-19b-2-5p MimicAGUUUUGCAGGUUUGCAUUUCA5 nmol¥38,000
INH0043hsa-miR-19b-2-5p InhibitorAGUUUUGCAGGUUUGCAUUUCA5 nmol¥38,000
MIM0045hsa-miR-19b-3p MimicUGUGCAAAUCCAUGCAAAACUGA5 nmol¥38,000
INH0045hsa-miR-19b-3p InhibitorUGUGCAAAUCCAUGCAAAACUGA5 nmol¥38,000
MIM0047hsa-miR-20a-3p MimicACUGCAUUAUGAGCACUUAAAG5 nmol¥38,000
INH0047hsa-miR-20a-3p InhibitorACUGCAUUAUGAGCACUUAAAG5 nmol¥38,000
MIM0050hsa-miR-20a-5p MimicUAAAGUGCUUAUAGUGCAGGUAG5 nmol¥38,000
INH0050hsa-miR-20a-5p InhibitorUAAAGUGCUUAUAGUGCAGGUAG5 nmol¥38,000
MIM0048hsa-miR-20b-3p MimicACUGUAGUAUGGGCACUUCCAG5 nmol¥38,000
INH0048hsa-miR-20b-3p InhibitorACUGUAGUAUGGGCACUUCCAG5 nmol¥38,000
MIM0049hsa-miR-20b-5p MimicCAAAGUGCUCAUAGUGCAGGUAG5 nmol¥38,000
INH0049hsa-miR-20b-5p InhibitorCAAAGUGCUCAUAGUGCAGGUAG5 nmol¥38,000
MIM0051hsa-miR-21-3p MimicCAACACCAGUCGAUGGGCUGU5 nmol¥38,000
INH0051hsa-miR-21-3p InhibitorCAACACCAGUCGAUGGGCUGU5 nmol¥38,000
MIM0052hsa-miR-21-5p MimicUAGCUUAUCAGACUGAUGUUGA5 nmol¥38,000
INH0052hsa-miR-21-5p InhibitorUAGCUUAUCAGACUGAUGUUGA5 nmol¥38,000
MIM0053hsa-miR-22-3p MimicAAGCUGCCAGUUGAAGAACUGU5 nmol¥38,000
INH0053hsa-miR-22-3p InhibitorAAGCUGCCAGUUGAAGAACUGU5 nmol¥38,000
MIM0054hsa-miR-22-5p MimicAGUUCUUCAGUGGCAAGCUUUA5 nmol¥38,000
INH0054hsa-miR-22-5p InhibitorAGUUCUUCAGUGGCAAGCUUUA5 nmol¥38,000
MIM0056hsa-miR-23a-3p MimicAUCACAUUGCCAGGGAUUUCC5 nmol¥38,000
INH0056hsa-miR-23a-3p InhibitorAUCACAUUGCCAGGGAUUUCC5 nmol¥38,000
MIM0057hsa-miR-23a-5p MimicGGGGUUCCUGGGGAUGGGAUUU5 nmol¥38,000
INH0057hsa-miR-23a-5p InhibitorGGGGUUCCUGGGGAUGGGAUUU5 nmol¥38,000
MIM0055hsa-miR-23b-3p MimicAUCACAUUGCCAGGGAUUACC5 nmol¥38,000
INH0055hsa-miR-23b-3p InhibitorAUCACAUUGCCAGGGAUUACC5 nmol¥38,000
MIM0058hsa-miR-23b-5p MimicUGGGUUCCUGGCAUGCUGAUUU5 nmol¥38,000
INH0058hsa-miR-23b-5p InhibitorUGGGUUCCUGGCAUGCUGAUUU5 nmol¥38,000
MIM0060hsa-miR-24-1-5p MimicUGCCUACUGAGCUGAUAUCAGU5 nmol¥38,000
INH0060hsa-miR-24-1-5p InhibitorUGCCUACUGAGCUGAUAUCAGU5 nmol¥38,000
MIM0059hsa-miR-24-2-5p MimicUGCCUACUGAGCUGAAACACAG5 nmol¥38,000
INH0059hsa-miR-24-2-5p InhibitorUGCCUACUGAGCUGAAACACAG5 nmol¥38,000
MIM0061hsa-miR-24-3p MimicUGGCUCAGUUCAGCAGGAACAG5 nmol¥38,000
INH0061hsa-miR-24-3p InhibitorUGGCUCAGUUCAGCAGGAACAG5 nmol¥38,000
MIM0063hsa-miR-25-3p MimicCAUUGCACUUGUCUCGGUCUGA5 nmol¥38,000
INH0063hsa-miR-25-3p InhibitorCAUUGCACUUGUCUCGGUCUGA5 nmol¥38,000
MIM0062hsa-miR-25-5p MimicAGGCGGAGACUUGGGCAAUUG5 nmol¥38,000
INH0062hsa-miR-25-5p InhibitorAGGCGGAGACUUGGGCAAUUG5 nmol¥38,000
MIM0065hsa-miR-26a-1-3p MimicCCUAUUCUUGGUUACUUGCACG5 nmol¥38,000
INH0065hsa-miR-26a-1-3p InhibitorCCUAUUCUUGGUUACUUGCACG5 nmol¥38,000
MIM0064hsa-miR-26a-2-3p MimicCCUAUUCUUGAUUACUUGUUUC5 nmol¥38,000
INH0064hsa-miR-26a-2-3p InhibitorCCUAUUCUUGAUUACUUGUUUC5 nmol¥38,000
MIM0067hsa-miR-26a-5p MimicUUCAAGUAAUCCAGGAUAGGCU5 nmol¥38,000
INH0067hsa-miR-26a-5p InhibitorUUCAAGUAAUCCAGGAUAGGCU5 nmol¥38,000
MIM0066hsa-miR-26b-3p MimicCCUGUUCUCCAUUACUUGGCUC5 nmol¥38,000
INH0066hsa-miR-26b-3p InhibitorCCUGUUCUCCAUUACUUGGCUC5 nmol¥38,000
MIM0068hsa-miR-26b-5p MimicUUCAAGUAAUUCAGGAUAGGU5 nmol¥38,000
INH0068hsa-miR-26b-5p InhibitorUUCAAGUAAUUCAGGAUAGGU5 nmol¥38,000
MIM0071hsa-miR-27a-3p MimicUUCACAGUGGCUAAGUUCCGC5 nmol¥38,000
INH0071hsa-miR-27a-3p InhibitorUUCACAGUGGCUAAGUUCCGC5 nmol¥38,000
MIM0070hsa-miR-27a-5p MimicAGGGCUUAGCUGCUUGUGAGCA5 nmol¥38,000
INH0070hsa-miR-27a-5p InhibitorAGGGCUUAGCUGCUUGUGAGCA5 nmol¥38,000
MIM0072hsa-miR-27b-3p MimicUUCACAGUGGCUAAGUUCUGC5 nmol¥38,000
INH0072hsa-miR-27b-3p InhibitorUUCACAGUGGCUAAGUUCUGC5 nmol¥38,000
MIM0069hsa-miR-27b-5p MimicAGAGCUUAGCUGAUUGGUGAAC5 nmol¥38,000
INH0069hsa-miR-27b-5p InhibitorAGAGCUUAGCUGAUUGGUGAAC5 nmol¥38,000
MIM0074hsa-miR-28-3p MimicCACUAGAUUGUGAGCUCCUGGA5 nmol¥38,000
INH0074hsa-miR-28-3p InhibitorCACUAGAUUGUGAGCUCCUGGA5 nmol¥38,000
MIM0073hsa-miR-28-5p MimicAAGGAGCUCACAGUCUAUUGAG5 nmol¥38,000
INH0073hsa-miR-28-5p InhibitorAAGGAGCUCACAGUCUAUUGAG5 nmol¥38,000
MIM0078hsa-miR-29a-3p MimicUAGCACCAUCUGAAAUCGGUUA5 nmol¥38,000
INH0078hsa-miR-29a-3p InhibitorUAGCACCAUCUGAAAUCGGUUA5 nmol¥38,000
MIM0075hsa-miR-29a-5p MimicACUGAUUUCUUUUGGUGUUCAG5 nmol¥38,000
INH0075hsa-miR-29a-5p InhibitorACUGAUUUCUUUUGGUGUUCAG5 nmol¥38,000
MIM0077hsa-miR-29b-1-5p MimicGCUGGUUUCAUAUGGUGGUUUAGA5 nmol¥38,000
INH0077hsa-miR-29b-1-5p InhibitorGCUGGUUUCAUAUGGUGGUUUAGA5 nmol¥38,000
MIM0076hsa-miR-29b-2-5p MimicCUGGUUUCACAUGGUGGCUUAG5 nmol¥38,000
INH0076hsa-miR-29b-2-5p InhibitorCUGGUUUCACAUGGUGGCUUAG5 nmol¥38,000
MIM0079hsa-miR-29b-3p MimicUAGCACCAUUUGAAAUCAGUGUU5 nmol¥38,000
INH0079hsa-miR-29b-3p InhibitorUAGCACCAUUUGAAAUCAGUGUU5 nmol¥38,000
MIM0080hsa-miR-29c-3p MimicUAGCACCAUUUGAAAUCGGUUA5 nmol¥38,000
INH0080hsa-miR-29c-3p InhibitorUAGCACCAUUUGAAAUCGGUUA5 nmol¥38,000
MIM0081hsa-miR-29c-5p MimicUGACCGAUUUCUCCUGGUGUUC5 nmol¥38,000
INH0081hsa-miR-29c-5p InhibitorUGACCGAUUUCUCCUGGUGUUC5 nmol¥38,000
MIM0087hsa-miR-30a-3p MimicCUUUCAGUCGGAUGUUUGCAGC5 nmol¥38,000
INH0087hsa-miR-30a-3p InhibitorCUUUCAGUCGGAUGUUUGCAGC5 nmol¥38,000
MIM0091hsa-miR-30a-5p MimicUGUAAACAUCCUCGACUGGAAG5 nmol¥38,000
INH0091hsa-miR-30a-5p InhibitorUGUAAACAUCCUCGACUGGAAG5 nmol¥38,000
MIM0084hsa-miR-30b-3p MimicCUGGGAGGUGGAUGUUUACUUC5 nmol¥38,000
INH0084hsa-miR-30b-3p InhibitorCUGGGAGGUGGAUGUUUACUUC5 nmol¥38,000
MIM0089hsa-miR-30b-5p MimicUGUAAACAUCCUACACUCAGCU5 nmol¥38,000
INH0089hsa-miR-30b-5p InhibitorUGUAAACAUCCUACACUCAGCU5 nmol¥38,000
MIM0083hsa-miR-30c-1-3p MimicCUGGGAGAGGGUUGUUUACUCC5 nmol¥38,000
INH0083hsa-miR-30c-1-3p InhibitorCUGGGAGAGGGUUGUUUACUCC5 nmol¥38,000
MIM0082hsa-miR-30c-2-3p MimicCUGGGAGAAGGCUGUUUACUCU5 nmol¥38,000
INH0082hsa-miR-30c-2-3p InhibitorCUGGGAGAAGGCUGUUUACUCU5 nmol¥38,000
MIM0090hsa-miR-30c-5p MimicUGUAAACAUCCUACACUCUCAGC5 nmol¥38,000
INH0090hsa-miR-30c-5p InhibitorUGUAAACAUCCUACACUCUCAGC5 nmol¥38,000
MIM0085hsa-miR-30d-3p MimicCUUUCAGUCAGAUGUUUGCUGC5 nmol¥38,000
INH0085hsa-miR-30d-3p InhibitorCUUUCAGUCAGAUGUUUGCUGC5 nmol¥38,000
MIM0088hsa-miR-30d-5p MimicUGUAAACAUCCCCGACUGGAAG5 nmol¥38,000
INH0088hsa-miR-30d-5p InhibitorUGUAAACAUCCCCGACUGGAAG5 nmol¥38,000
MIM0086hsa-miR-30e-3p MimicCUUUCAGUCGGAUGUUUACAGC5 nmol¥38,000
INH0086hsa-miR-30e-3p InhibitorCUUUCAGUCGGAUGUUUACAGC5 nmol¥38,000
MIM0092hsa-miR-30e-5p MimicUGUAAACAUCCUUGACUGGAAG5 nmol¥38,000
INH0092hsa-miR-30e-5p InhibitorUGUAAACAUCCUUGACUGGAAG5 nmol¥38,000
MIM0094hsa-miR-31-3p MimicUGCUAUGCCAACAUAUUGCCAU5 nmol¥38,000
INH0094hsa-miR-31-3p InhibitorUGCUAUGCCAACAUAUUGCCAU5 nmol¥38,000
MIM0093hsa-miR-31-5p MimicAGGCAAGAUGCUGGCAUAGCU5 nmol¥38,000
INH0093hsa-miR-31-5p InhibitorAGGCAAGAUGCUGGCAUAGCU5 nmol¥38,000
MIM0095hsa-miR-32-3p MimicCAAUUUAGUGUGUGUGAUAUUU5 nmol¥38,000
INH0095hsa-miR-32-3p InhibitorCAAUUUAGUGUGUGUGAUAUUU5 nmol¥38,000
MIM0096hsa-miR-32-5p MimicUAUUGCACAUUACUAAGUUGCA5 nmol¥38,000
INH0096hsa-miR-32-5p InhibitorUAUUGCACAUUACUAAGUUGCA5 nmol¥38,000
MIM0097hsa-miR-33a-3p MimicCAAUGUUUCCACAGUGCAUCAC5 nmol¥38,000
INH0097hsa-miR-33a-3p InhibitorCAAUGUUUCCACAGUGCAUCAC5 nmol¥38,000
MIM0100hsa-miR-33a-5p MimicGUGCAUUGUAGUUGCAUUGCA5 nmol¥38,000
INH0100hsa-miR-33a-5p InhibitorGUGCAUUGUAGUUGCAUUGCA5 nmol¥38,000
MIM0098hsa-miR-33b-3p MimicCAGUGCCUCGGCAGUGCAGCCC5 nmol¥38,000
INH0098hsa-miR-33b-3p InhibitorCAGUGCCUCGGCAGUGCAGCCC5 nmol¥38,000
MIM0099hsa-miR-33b-5p MimicGUGCAUUGCUGUUGCAUUGC5 nmol¥38,000
INH0099hsa-miR-33b-5p InhibitorGUGCAUUGCUGUUGCAUUGC5 nmol¥38,000
MIM0104hsa-miR-34a-3p MimicCAAUCAGCAAGUAUACUGCCCU5 nmol¥38,000
INH0104hsa-miR-34a-3p InhibitorCAAUCAGCAAGUAUACUGCCCU5 nmol¥38,000
MIM0106hsa-miR-34a-5p MimicUGGCAGUGUCUUAGCUGGUUGU5 nmol¥38,000
INH0106hsa-miR-34a-5p InhibitorUGGCAGUGUCUUAGCUGGUUGU5 nmol¥38,000
MIM0103hsa-miR-34b-3p MimicCAAUCACUAACUCCACUGCCAU5 nmol¥38,000
INH0103hsa-miR-34b-3p InhibitorCAAUCACUAACUCCACUGCCAU5 nmol¥38,000
MIM0105hsa-miR-34b-5p MimicUAGGCAGUGUCAUUAGCUGAUUG5 nmol¥38,000
INH0105hsa-miR-34b-5p InhibitorUAGGCAGUGUCAUUAGCUGAUUG5 nmol¥38,000
MIM0101hsa-miR-34c-3p MimicAAUCACUAACCACACGGCCAGG5 nmol¥38,000
INH0101hsa-miR-34c-3p InhibitorAAUCACUAACCACACGGCCAGG5 nmol¥38,000
MIM0102hsa-miR-34c-5p MimicAGGCAGUGUAGUUAGCUGAUUGC5 nmol¥38,000
INH0102hsa-miR-34c-5p InhibitorAGGCAGUGUAGUUAGCUGAUUGC5 nmol¥38,000
MIM0108hsa-miR-92a-1-5p MimicAGGUUGGGAUCGGUUGCAAUGCU5 nmol¥38,000
INH0108hsa-miR-92a-1-5p InhibitorAGGUUGGGAUCGGUUGCAAUGCU5 nmol¥38,000
MIM0109hsa-miR-92a-2-5p MimicGGGUGGGGAUUUGUUGCAUUAC5 nmol¥38,000
INH0109hsa-miR-92a-2-5p InhibitorGGGUGGGGAUUUGUUGCAUUAC5 nmol¥38,000
MIM0111hsa-miR-92a-3p MimicUAUUGCACUUGUCCCGGCCUGU5 nmol¥38,000
INH0111hsa-miR-92a-3p InhibitorUAUUGCACUUGUCCCGGCCUGU5 nmol¥38,000
MIM0110hsa-miR-92b-3p MimicUAUUGCACUCGUCCCGGCCUCC5 nmol¥38,000
INH0110hsa-miR-92b-3p InhibitorUAUUGCACUCGUCCCGGCCUCC5 nmol¥38,000
MIM0107hsa-miR-92b-5p MimicAGGGACGGGACGCGGUGCAGUG5 nmol¥38,000
INH0107hsa-miR-92b-5p InhibitorAGGGACGGGACGCGGUGCAGUG5 nmol¥38,000
MIM0112hsa-miR-93-3p MimicACUGCUGAGCUAGCACUUCCCG5 nmol¥38,000
INH0112hsa-miR-93-3p InhibitorACUGCUGAGCUAGCACUUCCCG5 nmol¥38,000
MIM0113hsa-miR-93-5p MimicCAAAGUGCUGUUCGUGCAGGUAG5 nmol¥38,000
INH0113hsa-miR-93-5p InhibitorCAAAGUGCUGUUCGUGCAGGUAG5 nmol¥38,000
MIM0114hsa-miR-95 MimicUUCAACGGGUAUUUAUUGAGCA5 nmol¥38,000
INH0114hsa-miR-95 InhibitorUUCAACGGGUAUUUAUUGAGCA5 nmol¥38,000
MIM0115hsa-miR-96-3p MimicAAUCAUGUGCAGUGCCAAUAUG5 nmol¥38,000
INH0115hsa-miR-96-3p InhibitorAAUCAUGUGCAGUGCCAAUAUG5 nmol¥38,000
MIM0116hsa-miR-98 MimicUGAGGUAGUAAGUUGUAUUGUU5 nmol¥38,000
INH0116hsa-miR-98 InhibitorUGAGGUAGUAAGUUGUAUUGUU5 nmol¥38,000
MIM0118hsa-miR-99a-3p MimicCAAGCUCGCUUCUAUGGGUCUG5 nmol¥38,000
INH0118hsa-miR-99a-3p InhibitorCAAGCUCGCUUCUAUGGGUCUG5 nmol¥38,000
MIM0117hsa-miR-99a-5p MimicAACCCGUAGAUCCGAUCUUGUG5 nmol¥38,000
INH0117hsa-miR-99a-5p InhibitorAACCCGUAGAUCCGAUCUUGUG5 nmol¥38,000
MIM0119hsa-miR-99b-3p MimicCAAGCUCGUGUCUGUGGGUCCG5 nmol¥38,000
INH0119hsa-miR-99b-3p InhibitorCAAGCUCGUGUCUGUGGGUCCG5 nmol¥38,000
MIM0120hsa-miR-99b-5p MimicCACCCGUAGAACCGACCUUGCG5 nmol¥38,000
INH0120hsa-miR-99b-5p InhibitorCACCCGUAGAACCGACCUUGCG5 nmol¥38,000