miR-700...miR-999

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0674hsa-miR-708-3p MimicCAACUAGACUGUGAGCUUCUAG5 nmol¥38,000
INH0674hsa-miR-708-3p InhibitorCAACUAGACUGUGAGCUUCUAG5 nmol¥38,000
MIM0673hsa-miR-708-5p MimicAAGGAGCUUACAAUCUAGCUGGG5 nmol¥38,000
INH0673hsa-miR-708-5p InhibitorAAGGAGCUUACAAUCUAGCUGGG5 nmol¥38,000
MIM0675hsa-miR-720 MimicUCUCGCUGGGGCCUCCA5 nmol¥38,000
INH0675hsa-miR-720 InhibitorUCUCGCUGGGGCCUCCA5 nmol¥38,000
MIM0676hsa-miR-744-3p MimicCUGUUGCCACUAACCUCAACCU5 nmol¥38,000
INH0676hsa-miR-744-3p InhibitorCUGUUGCCACUAACCUCAACCU5 nmol¥38,000
MIM0677hsa-miR-744-5p MimicUGCGGGGCUAGGGCUAACAGCA5 nmol¥38,000
INH0677hsa-miR-744-5p InhibitorUGCGGGGCUAGGGCUAACAGCA5 nmol¥38,000
MIM0678hsa-miR-760 MimicCGGCUCUGGGUCUGUGGGGA5 nmol¥38,000
INH0678hsa-miR-760 InhibitorCGGCUCUGGGUCUGUGGGGA5 nmol¥38,000
MIM0679hsa-miR-765 MimicUGGAGGAGAAGGAAGGUGAUG5 nmol¥38,000
INH0679hsa-miR-765 InhibitorUGGAGGAGAAGGAAGGUGAUG5 nmol¥38,000
MIM0680hsa-miR-766-3p MimicACUCCAGCCCCACAGCCUCAGC5 nmol¥38,000
INH0680hsa-miR-766-3p InhibitorACUCCAGCCCCACAGCCUCAGC5 nmol¥38,000
MIM0681hsa-miR-767-3p MimicUCUGCUCAUACCCCAUGGUUUCU5 nmol¥38,000
INH0681hsa-miR-767-3p InhibitorUCUGCUCAUACCCCAUGGUUUCU5 nmol¥38,000
MIM0682hsa-miR-767-5p MimicUGCACCAUGGUUGUCUGAGCAUG5 nmol¥38,000
INH0682hsa-miR-767-5p InhibitorUGCACCAUGGUUGUCUGAGCAUG5 nmol¥38,000
MIM0683hsa-miR-769-3p MimicCUGGGAUCUCCGGGGUCUUGGUU5 nmol¥38,000
INH0683hsa-miR-769-3p InhibitorCUGGGAUCUCCGGGGUCUUGGUU5 nmol¥38,000
MIM0684hsa-miR-769-5p MimicUGAGACCUCUGGGUUCUGAGCU5 nmol¥38,000
INH0684hsa-miR-769-5p InhibitorUGAGACCUCUGGGUUCUGAGCU5 nmol¥38,000
MIM0685hsa-miR-770-5p MimicUCCAGUACCACGUGUCAGGGCCA5 nmol¥38,000
INH0685hsa-miR-770-5p InhibitorUCCAGUACCACGUGUCAGGGCCA5 nmol¥38,000
MIM0686hsa-miR-802 MimicCAGUAACAAAGAUUCAUCCUUGU5 nmol¥38,000
INH0686hsa-miR-802 InhibitorCAGUAACAAAGAUUCAUCCUUGU5 nmol¥38,000
MIM0687hsa-miR-873-5p MimicGCAGGAACUUGUGAGUCUCCU5 nmol¥38,000
INH0687hsa-miR-873-5p InhibitorGCAGGAACUUGUGAGUCUCCU5 nmol¥38,000
MIM0688hsa-miR-874 MimicCUGCCCUGGCCCGAGGGACCGA5 nmol¥38,000
INH0688hsa-miR-874 InhibitorCUGCCCUGGCCCGAGGGACCGA5 nmol¥38,000
MIM0689hsa-miR-875-3p MimicCCUGGAAACACUGAGGUUGUG5 nmol¥38,000
INH0689hsa-miR-875-3p InhibitorCCUGGAAACACUGAGGUUGUG5 nmol¥38,000
MIM0690hsa-miR-875-5p MimicUAUACCUCAGUUUUAUCAGGUG5 nmol¥38,000
INH0690hsa-miR-875-5p InhibitorUAUACCUCAGUUUUAUCAGGUG5 nmol¥38,000
MIM0692hsa-miR-876-3p MimicUGGUGGUUUACAAAGUAAUUCA5 nmol¥38,000
INH0692hsa-miR-876-3p InhibitorUGGUGGUUUACAAAGUAAUUCA5 nmol¥38,000
MIM0691hsa-miR-876-5p MimicUGGAUUUCUUUGUGAAUCACCA5 nmol¥38,000
INH0691hsa-miR-876-5p InhibitorUGGAUUUCUUUGUGAAUCACCA5 nmol¥38,000
MIM0694hsa-miR-877-3p MimicUCCUCUUCUCCCUCCUCCCAG5 nmol¥38,000
INH0694hsa-miR-877-3p InhibitorUCCUCUUCUCCCUCCUCCCAG5 nmol¥38,000
MIM0693hsa-miR-877-5p MimicGUAGAGGAGAUGGCGCAGGG5 nmol¥38,000
INH0693hsa-miR-877-5p InhibitorGUAGAGGAGAUGGCGCAGGG5 nmol¥38,000
MIM0695hsa-miR-885-3p MimicAGGCAGCGGGGUGUAGUGGAUA5 nmol¥38,000
INH0695hsa-miR-885-3p InhibitorAGGCAGCGGGGUGUAGUGGAUA5 nmol¥38,000
MIM0696hsa-miR-885-5p MimicUCCAUUACACUACCCUGCCUCU5 nmol¥38,000
INH0696hsa-miR-885-5p InhibitorUCCAUUACACUACCCUGCCUCU5 nmol¥38,000
MIM0699hsa-miR-887 MimicGUGAACGGGCGCCAUCCCGAGG5 nmol¥38,000
INH0699hsa-miR-887 InhibitorGUGAACGGGCGCCAUCCCGAGG5 nmol¥38,000
MIM0700hsa-miR-888-3p MimicGACUGACACCUCUUUGGGUGAA5 nmol¥38,000
INH0700hsa-miR-888-3p InhibitorGACUGACACCUCUUUGGGUGAA5 nmol¥38,000
MIM0701hsa-miR-888-5p MimicUACUCAAAAAGCUGUCAGUCA5 nmol¥38,000
INH0701hsa-miR-888-5p InhibitorUACUCAAAAAGCUGUCAGUCA5 nmol¥38,000
MIM0702hsa-miR-889 MimicUUAAUAUCGGACAACCAUUGU5 nmol¥38,000
INH0702hsa-miR-889 InhibitorUUAAUAUCGGACAACCAUUGU5 nmol¥38,000
MIM0703hsa-miR-890 MimicUACUUGGAAAGGCAUCAGUUG5 nmol¥38,000
INH0703hsa-miR-890 InhibitorUACUUGGAAAGGCAUCAGUUG5 nmol¥38,000
MIM0704hsa-miR-891a MimicUGCAACGAACCUGAGCCACUGA5 nmol¥38,000
INH0704hsa-miR-891a InhibitorUGCAACGAACCUGAGCCACUGA5 nmol¥38,000
MIM0705hsa-miR-891b MimicUGCAACUUACCUGAGUCAUUGA5 nmol¥38,000
INH0705hsa-miR-891b InhibitorUGCAACUUACCUGAGUCAUUGA5 nmol¥38,000
MIM0707hsa-miR-892a MimicCACUGUGUCCUUUCUGCGUAG5 nmol¥38,000
INH0707hsa-miR-892a InhibitorCACUGUGUCCUUUCUGCGUAG5 nmol¥38,000
MIM0706hsa-miR-892b MimicCACUGGCUCCUUUCUGGGUAGA5 nmol¥38,000
INH0706hsa-miR-892b InhibitorCACUGGCUCCUUUCUGGGUAGA5 nmol¥38,000
MIM0708hsa-miR-920 MimicGGGGAGCUGUGGAAGCAGUA5 nmol¥38,000
INH0708hsa-miR-920 InhibitorGGGGAGCUGUGGAAGCAGUA5 nmol¥38,000
MIM0709hsa-miR-921 MimicCUAGUGAGGGACAGAACCAGGAUUC5 nmol¥38,000
INH0709hsa-miR-921 InhibitorCUAGUGAGGGACAGAACCAGGAUUC5 nmol¥38,000
MIM0710hsa-miR-922 MimicGCAGCAGAGAAUAGGACUACGUC5 nmol¥38,000
INH0710hsa-miR-922 InhibitorGCAGCAGAGAAUAGGACUACGUC5 nmol¥38,000
MIM0711hsa-miR-924 MimicAGAGUCUUGUGAUGUCUUGC5 nmol¥38,000
INH0711hsa-miR-924 InhibitorAGAGUCUUGUGAUGUCUUGC5 nmol¥38,000
MIM0712hsa-miR-933 MimicUGUGCGCAGGGAGACCUCUCCC5 nmol¥38,000
INH0712hsa-miR-933 InhibitorUGUGCGCAGGGAGACCUCUCCC5 nmol¥38,000
MIM0713hsa-miR-934 MimicUGUCUACUACUGGAGACACUGG5 nmol¥38,000
INH0713hsa-miR-934 InhibitorUGUCUACUACUGGAGACACUGG5 nmol¥38,000
MIM0714hsa-miR-935 MimicCCAGUUACCGCUUCCGCUACCGC5 nmol¥38,000
INH0714hsa-miR-935 InhibitorCCAGUUACCGCUUCCGCUACCGC5 nmol¥38,000
MIM0715hsa-miR-936 MimicACAGUAGAGGGAGGAAUCGCAG5 nmol¥38,000
INH0715hsa-miR-936 InhibitorACAGUAGAGGGAGGAAUCGCAG5 nmol¥38,000
MIM0716hsa-miR-937 MimicAUCCGCGCUCUGACUCUCUGCC5 nmol¥38,000
INH0716hsa-miR-937 InhibitorAUCCGCGCUCUGACUCUCUGCC5 nmol¥38,000
MIM0717hsa-miR-938 MimicUGCCCUUAAAGGUGAACCCAGU5 nmol¥38,000
INH0717hsa-miR-938 InhibitorUGCCCUUAAAGGUGAACCCAGU5 nmol¥38,000
MIM0718hsa-miR-939 MimicUGGGGAGCUGAGGCUCUGGGGGUG5 nmol¥38,000
INH0718hsa-miR-939 InhibitorUGGGGAGCUGAGGCUCUGGGGGUG5 nmol¥38,000
MIM0719hsa-miR-940 MimicAAGGCAGGGCCCCCGCUCCCC5 nmol¥38,000
INH0719hsa-miR-940 InhibitorAAGGCAGGGCCCCCGCUCCCC5 nmol¥38,000
MIM0720hsa-miR-941 MimicCACCCGGCUGUGUGCACAUGUGC5 nmol¥38,000
INH0720hsa-miR-941 InhibitorCACCCGGCUGUGUGCACAUGUGC5 nmol¥38,000
MIM0721hsa-miR-942 MimicUCUUCUCUGUUUUGGCCAUGUG5 nmol¥38,000
INH0721hsa-miR-942 InhibitorUCUUCUCUGUUUUGGCCAUGUG5 nmol¥38,000
MIM0722hsa-miR-943 MimicCUGACUGUUGCCGUCCUCCAG5 nmol¥38,000
INH0722hsa-miR-943 InhibitorCUGACUGUUGCCGUCCUCCAG5 nmol¥38,000
MIM0723hsa-miR-944 MimicAAAUUAUUGUACAUCGGAUGAG5 nmol¥38,000
INH0723hsa-miR-944 InhibitorAAAUUAUUGUACAUCGGAUGAG5 nmol¥38,000