miR-1000...miR-2300

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. 

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 

 

Product IDNameSequenceFormatPrice
MIM9001Non-targeting miRNA Mimic v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
INH9001Non-targeting miRNA Inhibitor v1UCACAACCUCCUAGAAAGAGUAGA5 nmol¥38,000
MIM9002Non-targeting miRNA Mimic v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
INH9002Non-targeting miRNA Inhibitor v2UUGUACUACACAAAAGUACUG5 nmol¥38,000
MIM0724hsa-miR-1178 MimicUUGCUCACUGUUCUUCCCUAG5 nmol¥38,000
INH0724hsa-miR-1178 InhibitorUUGCUCACUGUUCUUCCCUAG5 nmol¥38,000
MIM0725hsa-miR-1179 MimicAAGCAUUCUUUCAUUGGUUGG5 nmol¥38,000
INH0725hsa-miR-1179 InhibitorAAGCAUUCUUUCAUUGGUUGG5 nmol¥38,000
MIM0726hsa-miR-1181 MimicCCGUCGCCGCCACCCGAGCCG5 nmol¥38,000
INH0726hsa-miR-1181 InhibitorCCGUCGCCGCCACCCGAGCCG5 nmol¥38,000
MIM0727hsa-miR-1182 MimicGAGGGUCUUGGGAGGGAUGUGAC5 nmol¥38,000
INH0727hsa-miR-1182 InhibitorGAGGGUCUUGGGAGGGAUGUGAC5 nmol¥38,000
MIM0728hsa-miR-1183 MimicCACUGUAGGUGAUGGUGAGAGUGGGCA5 nmol¥38,000
INH0728hsa-miR-1183 InhibitorCACUGUAGGUGAUGGUGAGAGUGGGCA5 nmol¥38,000
MIM0729hsa-miR-1184 MimicCCUGCAGCGACUUGAUGGCUUCC5 nmol¥38,000
INH0729hsa-miR-1184 InhibitorCCUGCAGCGACUUGAUGGCUUCC5 nmol¥38,000
MIM0730hsa-miR-1185-5p MimicAGAGGAUACCCUUUGUAUGUU5 nmol¥38,000
INH0730hsa-miR-1185-5p InhibitorAGAGGAUACCCUUUGUAUGUU5 nmol¥38,000
MIM0731hsa-miR-1197 MimicUAGGACACAUGGUCUACUUCU5 nmol¥38,000
INH0731hsa-miR-1197 InhibitorUAGGACACAUGGUCUACUUCU5 nmol¥38,000
MIM0732hsa-miR-1200 MimicCUCCUGAGCCAUUCUGAGCCUC5 nmol¥38,000
INH0732hsa-miR-1200 InhibitorCUCCUGAGCCAUUCUGAGCCUC5 nmol¥38,000
MIM0734hsa-miR-1202 MimicGUGCCAGCUGCAGUGGGGGAG5 nmol¥38,000
INH0734hsa-miR-1202 InhibitorGUGCCAGCUGCAGUGGGGGAG5 nmol¥38,000
MIM0735hsa-miR-1203 MimicCCCGGAGCCAGGAUGCAGCUC5 nmol¥38,000
INH0735hsa-miR-1203 InhibitorCCCGGAGCCAGGAUGCAGCUC5 nmol¥38,000
MIM0736hsa-miR-1204 MimicUCGUGGCCUGGUCUCCAUUAU5 nmol¥38,000
INH0736hsa-miR-1204 InhibitorUCGUGGCCUGGUCUCCAUUAU5 nmol¥38,000
MIM0737hsa-miR-1205 MimicUCUGCAGGGUUUGCUUUGAG5 nmol¥38,000
INH0737hsa-miR-1205 InhibitorUCUGCAGGGUUUGCUUUGAG5 nmol¥38,000
MIM0738hsa-miR-1206 MimicUGUUCAUGUAGAUGUUUAAGC5 nmol¥38,000
INH0738hsa-miR-1206 InhibitorUGUUCAUGUAGAUGUUUAAGC5 nmol¥38,000
MIM0739hsa-miR-1207-3p MimicUCAGCUGGCCCUCAUUUC5 nmol¥38,000
INH0739hsa-miR-1207-3p InhibitorUCAGCUGGCCCUCAUUUC5 nmol¥38,000
MIM0740hsa-miR-1207-5p MimicUGGCAGGGAGGCUGGGAGGGG5 nmol¥38,000
INH0740hsa-miR-1207-5p InhibitorUGGCAGGGAGGCUGGGAGGGG5 nmol¥38,000
MIM0741hsa-miR-1208 MimicUCACUGUUCAGACAGGCGGA5 nmol¥38,000
INH0741hsa-miR-1208 InhibitorUCACUGUUCAGACAGGCGGA5 nmol¥38,000
MIM0742hsa-miR-1224-3p MimicCCCCACCUCCUCUCUCCUCAG5 nmol¥38,000
INH0742hsa-miR-1224-3p InhibitorCCCCACCUCCUCUCUCCUCAG5 nmol¥38,000
MIM0743hsa-miR-1224-5p MimicGUGAGGACUCGGGAGGUGG5 nmol¥38,000
INH0743hsa-miR-1224-5p InhibitorGUGAGGACUCGGGAGGUGG5 nmol¥38,000
MIM0745hsa-miR-1225-3p MimicUGAGCCCCUGUGCCGCCCCCAG5 nmol¥38,000
INH0745hsa-miR-1225-3p InhibitorUGAGCCCCUGUGCCGCCCCCAG5 nmol¥38,000
MIM0744hsa-miR-1225-5p MimicGUGGGUACGGCCCAGUGGGGGG5 nmol¥38,000
INH0744hsa-miR-1225-5p InhibitorGUGGGUACGGCCCAGUGGGGGG5 nmol¥38,000
MIM0747hsa-miR-1226-3p MimicUCACCAGCCCUGUGUUCCCUAG5 nmol¥38,000
INH0747hsa-miR-1226-3p InhibitorUCACCAGCCCUGUGUUCCCUAG5 nmol¥38,000
MIM0746hsa-miR-1226-5p MimicGUGAGGGCAUGCAGGCCUGGAUGGGG5 nmol¥38,000
INH0746hsa-miR-1226-5p InhibitorGUGAGGGCAUGCAGGCCUGGAUGGGG5 nmol¥38,000
MIM0748hsa-miR-1227 MimicCGUGCCACCCUUUUCCCCAG5 nmol¥38,000
INH0748hsa-miR-1227 InhibitorCGUGCCACCCUUUUCCCCAG5 nmol¥38,000
MIM0750hsa-miR-1228-3p MimicUCACACCUGCCUCGCCCCCC5 nmol¥38,000
INH0750hsa-miR-1228-3p InhibitorUCACACCUGCCUCGCCCCCC5 nmol¥38,000
MIM0749hsa-miR-1228-5p MimicGUGGGCGGGGGCAGGUGUGUG5 nmol¥38,000
INH0749hsa-miR-1228-5p InhibitorGUGGGCGGGGGCAGGUGUGUG5 nmol¥38,000
MIM0751hsa-miR-1229 MimicCUCUCACCACUGCCCUCCCACAG5 nmol¥38,000
INH0751hsa-miR-1229 InhibitorCUCUCACCACUGCCCUCCCACAG5 nmol¥38,000
MIM0752hsa-miR-1231 MimicGUGUCUGGGCGGACAGCUGC5 nmol¥38,000
INH0752hsa-miR-1231 InhibitorGUGUCUGGGCGGACAGCUGC5 nmol¥38,000
MIM0753hsa-miR-1233 MimicUGAGCCCUGUCCUCCCGCAG5 nmol¥38,000
INH0753hsa-miR-1233 InhibitorUGAGCCCUGUCCUCCCGCAG5 nmol¥38,000
MIM0754hsa-miR-1234 MimicUCGGCCUGACCACCCACCCCAC5 nmol¥38,000
INH0754hsa-miR-1234 InhibitorUCGGCCUGACCACCCACCCCAC5 nmol¥38,000
MIM0755hsa-miR-1236 MimicCCUCUUCCCCUUGUCUCUCCAG5 nmol¥38,000
INH0755hsa-miR-1236 InhibitorCCUCUUCCCCUUGUCUCUCCAG5 nmol¥38,000
MIM0756hsa-miR-1237 MimicUCCUUCUGCUCCGUCCCCCAG5 nmol¥38,000
INH0756hsa-miR-1237 InhibitorUCCUUCUGCUCCGUCCCCCAG5 nmol¥38,000
MIM0757hsa-miR-1238 MimicCUUCCUCGUCUGUCUGCCCC5 nmol¥38,000
INH0757hsa-miR-1238 InhibitorCUUCCUCGUCUGUCUGCCCC5 nmol¥38,000
MIM0758hsa-miR-1243 MimicAACUGGAUCAAUUAUAGGAGUG5 nmol¥38,000
INH0758hsa-miR-1243 InhibitorAACUGGAUCAAUUAUAGGAGUG5 nmol¥38,000
MIM0759hsa-miR-1244 MimicAAGUAGUUGGUUUGUAUGAGAUGGUU5 nmol¥38,000
INH0759hsa-miR-1244 InhibitorAAGUAGUUGGUUUGUAUGAGAUGGUU5 nmol¥38,000
MIM0760hsa-miR-1245a MimicAAGUGAUCUAAAGGCCUACAU5 nmol¥38,000
INH0760hsa-miR-1245a InhibitorAAGUGAUCUAAAGGCCUACAU5 nmol¥38,000
MIM0761hsa-miR-1246 MimicAAUGGAUUUUUGGAGCAGG5 nmol¥38,000
INH0761hsa-miR-1246 InhibitorAAUGGAUUUUUGGAGCAGG5 nmol¥38,000
MIM0762hsa-miR-1247-5p MimicACCCGUCCCGUUCGUCCCCGGA5 nmol¥38,000
INH0762hsa-miR-1247-5p InhibitorACCCGUCCCGUUCGUCCCCGGA5 nmol¥38,000
MIM0763hsa-miR-1248 MimicACCUUCUUGUAUAAGCACUGUGCUAAA5 nmol¥38,000
INH0763hsa-miR-1248 InhibitorACCUUCUUGUAUAAGCACUGUGCUAAA5 nmol¥38,000
MIM0764hsa-miR-1249 MimicACGCCCUUCCCCCCCUUCUUCA5 nmol¥38,000
INH0764hsa-miR-1249 InhibitorACGCCCUUCCCCCCCUUCUUCA5 nmol¥38,000
MIM0765hsa-miR-1250 MimicACGGUGCUGGAUGUGGCCUUU5 nmol¥38,000
INH0765hsa-miR-1250 InhibitorACGGUGCUGGAUGUGGCCUUU5 nmol¥38,000
MIM0766hsa-miR-1251 MimicACUCUAGCUGCCAAAGGCGCU5 nmol¥38,000
INH0766hsa-miR-1251 InhibitorACUCUAGCUGCCAAAGGCGCU5 nmol¥38,000
MIM0767hsa-miR-1252 MimicAGAAGGAAAUUGAAUUCAUUUA5 nmol¥38,000
INH0767hsa-miR-1252 InhibitorAGAAGGAAAUUGAAUUCAUUUA5 nmol¥38,000
MIM0768hsa-miR-1253 MimicAGAGAAGAAGAUCAGCCUGCA5 nmol¥38,000
INH0768hsa-miR-1253 InhibitorAGAGAAGAAGAUCAGCCUGCA5 nmol¥38,000
MIM0769hsa-miR-1254 MimicAGCCUGGAAGCUGGAGCCUGCAGU5 nmol¥38,000
INH0769hsa-miR-1254 InhibitorAGCCUGGAAGCUGGAGCCUGCAGU5 nmol¥38,000
MIM0770hsa-miR-1255a MimicAGGAUGAGCAAAGAAAGUAGAUU5 nmol¥38,000
INH0770hsa-miR-1255a InhibitorAGGAUGAGCAAAGAAAGUAGAUU5 nmol¥38,000
MIM0771hsa-miR-1255b-5p MimicCGGAUGAGCAAAGAAAGUGGUU5 nmol¥38,000
INH0771hsa-miR-1255b-5p InhibitorCGGAUGAGCAAAGAAAGUGGUU5 nmol¥38,000
MIM0772hsa-miR-1256 MimicAGGCAUUGACUUCUCACUAGCU5 nmol¥38,000
INH0772hsa-miR-1256 InhibitorAGGCAUUGACUUCUCACUAGCU5 nmol¥38,000
MIM0773hsa-miR-1257 MimicAGUGAAUGAUGGGUUCUGACC5 nmol¥38,000
INH0773hsa-miR-1257 InhibitorAGUGAAUGAUGGGUUCUGACC5 nmol¥38,000
MIM0774hsa-miR-1258 MimicAGUUAGGAUUAGGUCGUGGAA5 nmol¥38,000
INH0774hsa-miR-1258 InhibitorAGUUAGGAUUAGGUCGUGGAA5 nmol¥38,000
MIM0776hsa-miR-1260a MimicAUCCCACCUCUGCCACCA5 nmol¥38,000
INH0776hsa-miR-1260a InhibitorAUCCCACCUCUGCCACCA5 nmol¥38,000
MIM0777hsa-miR-1261 MimicAUGGAUAAGGCUUUGGCUU5 nmol¥38,000
INH0777hsa-miR-1261 InhibitorAUGGAUAAGGCUUUGGCUU5 nmol¥38,000
MIM0778hsa-miR-1262 MimicAUGGGUGAAUUUGUAGAAGGAU5 nmol¥38,000
INH0778hsa-miR-1262 InhibitorAUGGGUGAAUUUGUAGAAGGAU5 nmol¥38,000
MIM0779hsa-miR-1263 MimicAUGGUACCCUGGCAUACUGAGU5 nmol¥38,000
INH0779hsa-miR-1263 InhibitorAUGGUACCCUGGCAUACUGAGU5 nmol¥38,000
MIM0780hsa-miR-1264 MimicCAAGUCUUAUUUGAGCACCUGUU5 nmol¥38,000
INH0780hsa-miR-1264 InhibitorCAAGUCUUAUUUGAGCACCUGUU5 nmol¥38,000
MIM0781hsa-miR-1265 MimicCAGGAUGUGGUCAAGUGUUGUU5 nmol¥38,000
INH0781hsa-miR-1265 InhibitorCAGGAUGUGGUCAAGUGUUGUU5 nmol¥38,000
MIM0782hsa-miR-1266 MimicCCUCAGGGCUGUAGAACAGGGCU5 nmol¥38,000
INH0782hsa-miR-1266 InhibitorCCUCAGGGCUGUAGAACAGGGCU5 nmol¥38,000
MIM0783hsa-miR-1267 MimicCCUGUUGAAGUGUAAUCCCCA5 nmol¥38,000
INH0783hsa-miR-1267 InhibitorCCUGUUGAAGUGUAAUCCCCA5 nmol¥38,000
MIM0784hsa-miR-1268a MimicCGGGCGUGGUGGUGGGGG5 nmol¥38,000
INH0784hsa-miR-1268a InhibitorCGGGCGUGGUGGUGGGGG5 nmol¥38,000
MIM0785hsa-miR-1269a MimicCUGGACUGAGCCGUGCUACUGG5 nmol¥38,000
INH0785hsa-miR-1269a InhibitorCUGGACUGAGCCGUGCUACUGG5 nmol¥38,000
MIM0786hsa-miR-1270 MimicCUGGAGAUAUGGAAGAGCUGUGU5 nmol¥38,000
INH0786hsa-miR-1270 InhibitorCUGGAGAUAUGGAAGAGCUGUGU5 nmol¥38,000
MIM0787hsa-miR-1271-5p MimicCUUGGCACCUAGCAAGCACUCA5 nmol¥38,000
INH0787hsa-miR-1271-5p InhibitorCUUGGCACCUAGCAAGCACUCA5 nmol¥38,000
MIM0788hsa-miR-1272 MimicGAUGAUGAUGGCAGCAAAUUCUGAAA5 nmol¥38,000
INH0788hsa-miR-1272 InhibitorGAUGAUGAUGGCAGCAAAUUCUGAAA5 nmol¥38,000
MIM0789hsa-miR-1273a MimicGGGCGACAAAGCAAGACUCUUUCUU5 nmol¥38,000
INH0789hsa-miR-1273a InhibitorGGGCGACAAAGCAAGACUCUUUCUU5 nmol¥38,000
MIM0792hsa-miR-1275 MimicGUGGGGGAGAGGCUGUC5 nmol¥38,000
INH0792hsa-miR-1275 InhibitorGUGGGGGAGAGGCUGUC5 nmol¥38,000
MIM0793hsa-miR-1276 MimicUAAAGAGCCCUGUGGAGACA5 nmol¥38,000
INH0793hsa-miR-1276 InhibitorUAAAGAGCCCUGUGGAGACA5 nmol¥38,000
MIM0794hsa-miR-1277-3p MimicUACGUAGAUAUAUAUGUAUUUU5 nmol¥38,000
INH0794hsa-miR-1277-3p InhibitorUACGUAGAUAUAUAUGUAUUUU5 nmol¥38,000
MIM0795hsa-miR-1278 MimicUAGUACUGUGCAUAUCAUCUAU5 nmol¥38,000
INH0795hsa-miR-1278 InhibitorUAGUACUGUGCAUAUCAUCUAU5 nmol¥38,000
MIM0796hsa-miR-1279 MimicUCAUAUUGCUUCUUUCU5 nmol¥38,000
INH0796hsa-miR-1279 InhibitorUCAUAUUGCUUCUUUCU5 nmol¥38,000
MIM0797hsa-miR-1280 MimicUCCCACCGCUGCCACCC5 nmol¥38,000
INH0797hsa-miR-1280 InhibitorUCCCACCGCUGCCACCC5 nmol¥38,000
MIM0798hsa-miR-1281 MimicUCGCCUCCUCCUCUCCC5 nmol¥38,000
INH0798hsa-miR-1281 InhibitorUCGCCUCCUCCUCUCCC5 nmol¥38,000
MIM0799hsa-miR-1282 MimicUCGUUUGCCUUUUUCUGCUU5 nmol¥38,000
INH0799hsa-miR-1282 InhibitorUCGUUUGCCUUUUUCUGCUU5 nmol¥38,000
MIM0800hsa-miR-1283 MimicUCUACAAAGGAAAGCGCUUUCU5 nmol¥38,000
INH0800hsa-miR-1283 InhibitorUCUACAAAGGAAAGCGCUUUCU5 nmol¥38,000
MIM0801hsa-miR-1284 MimicUCUAUACAGACCCUGGCUUUUC5 nmol¥38,000
INH0801hsa-miR-1284 InhibitorUCUAUACAGACCCUGGCUUUUC5 nmol¥38,000
MIM0802hsa-miR-1285-3p MimicUCUGGGCAACAAAGUGAGACCU5 nmol¥38,000
INH0802hsa-miR-1285-3p InhibitorUCUGGGCAACAAAGUGAGACCU5 nmol¥38,000
MIM0803hsa-miR-1286 MimicUGCAGGACCAAGAUGAGCCCU5 nmol¥38,000
INH0803hsa-miR-1286 InhibitorUGCAGGACCAAGAUGAGCCCU5 nmol¥38,000
MIM0804hsa-miR-1287 MimicUGCUGGAUCAGUGGUUCGAGUC5 nmol¥38,000
INH0804hsa-miR-1287 InhibitorUGCUGGAUCAGUGGUUCGAGUC5 nmol¥38,000
MIM0805hsa-miR-1288 MimicUGGACUGCCCUGAUCUGGAGA5 nmol¥38,000
INH0805hsa-miR-1288 InhibitorUGGACUGCCCUGAUCUGGAGA5 nmol¥38,000
MIM0806hsa-miR-1289 MimicUGGAGUCCAGGAAUCUGCAUUUU5 nmol¥38,000
INH0806hsa-miR-1289 InhibitorUGGAGUCCAGGAAUCUGCAUUUU5 nmol¥38,000
MIM0807hsa-miR-1290 MimicUGGAUUUUUGGAUCAGGGA5 nmol¥38,000
INH0807hsa-miR-1290 InhibitorUGGAUUUUUGGAUCAGGGA5 nmol¥38,000
MIM0808hsa-miR-1291 MimicUGGCCCUGACUGAAGACCAGCAGU5 nmol¥38,000
INH0808hsa-miR-1291 InhibitorUGGCCCUGACUGAAGACCAGCAGU5 nmol¥38,000
MIM0809hsa-miR-1292 MimicUGGGAACGGGUUCCGGCAGACGCUG5 nmol¥38,000
INH0809hsa-miR-1292 InhibitorUGGGAACGGGUUCCGGCAGACGCUG5 nmol¥38,000
MIM0810hsa-miR-1293 MimicUGGGUGGUCUGGAGAUUUGUGC5 nmol¥38,000
INH0810hsa-miR-1293 InhibitorUGGGUGGUCUGGAGAUUUGUGC5 nmol¥38,000
MIM0811hsa-miR-1294 MimicUGUGAGGUUGGCAUUGUUGUCU5 nmol¥38,000
INH0811hsa-miR-1294 InhibitorUGUGAGGUUGGCAUUGUUGUCU5 nmol¥38,000
MIM0812hsa-miR-1295a MimicUUAGGCCGCAGAUCUGGGUGA5 nmol¥38,000
INH0812hsa-miR-1295a InhibitorUUAGGCCGCAGAUCUGGGUGA5 nmol¥38,000
MIM0813hsa-miR-1296 MimicUUAGGGCCCUGGCUCCAUCUCC5 nmol¥38,000
INH0813hsa-miR-1296 InhibitorUUAGGGCCCUGGCUCCAUCUCC5 nmol¥38,000
MIM0814hsa-miR-1297 MimicUUCAAGUAAUUCAGGUG5 nmol¥38,000
INH0814hsa-miR-1297 InhibitorUUCAAGUAAUUCAGGUG5 nmol¥38,000
MIM0815hsa-miR-1298 MimicUUCAUUCGGCUGUCCAGAUGUA5 nmol¥38,000
INH0815hsa-miR-1298 InhibitorUUCAUUCGGCUGUCCAGAUGUA5 nmol¥38,000
MIM0816hsa-miR-1299 MimicUUCUGGAAUUCUGUGUGAGGGA5 nmol¥38,000
INH0816hsa-miR-1299 InhibitorUUCUGGAAUUCUGUGUGAGGGA5 nmol¥38,000
MIM0818hsa-miR-1301 MimicUUGCAGCUGCCUGGGAGUGACUUC5 nmol¥38,000
INH0818hsa-miR-1301 InhibitorUUGCAGCUGCCUGGGAGUGACUUC5 nmol¥38,000
MIM0819hsa-miR-1302 MimicUUGGGACAUACUUAUGCUAAA5 nmol¥38,000
INH0819hsa-miR-1302 InhibitorUUGGGACAUACUUAUGCUAAA5 nmol¥38,000
MIM0820hsa-miR-1303 MimicUUUAGAGACGGGGUCUUGCUCU5 nmol¥38,000
INH0820hsa-miR-1303 InhibitorUUUAGAGACGGGGUCUUGCUCU5 nmol¥38,000
MIM0821hsa-miR-1306-3p MimicACGUUGGCUCUGGUGGUG5 nmol¥38,000
INH0821hsa-miR-1306-3p InhibitorACGUUGGCUCUGGUGGUG5 nmol¥38,000
MIM0822hsa-miR-1307-3p MimicACUCGGCGUGGCGUCGGUCGUG5 nmol¥38,000
INH0822hsa-miR-1307-3p InhibitorACUCGGCGUGGCGUCGGUCGUG5 nmol¥38,000
MIM0824hsa-miR-1321 MimicCAGGGAGGUGAAUGUGAU5 nmol¥38,000
INH0824hsa-miR-1321 InhibitorCAGGGAGGUGAAUGUGAU5 nmol¥38,000
MIM0825hsa-miR-1322 MimicGAUGAUGCUGCUGAUGCUG5 nmol¥38,000
INH0825hsa-miR-1322 InhibitorGAUGAUGCUGCUGAUGCUG5 nmol¥38,000
MIM0826hsa-miR-1323 MimicUCAAAACUGAGGGGCAUUUUCU5 nmol¥38,000
INH0826hsa-miR-1323 InhibitorUCAAAACUGAGGGGCAUUUUCU5 nmol¥38,000
MIM0827hsa-miR-1324 MimicCCAGACAGAAUUCUAUGCACUUUC5 nmol¥38,000
INH0827hsa-miR-1324 InhibitorCCAGACAGAAUUCUAUGCACUUUC5 nmol¥38,000
MIM0828hsa-miR-1468 MimicCUCCGUUUGCCUGUUUCGCUG5 nmol¥38,000
INH0828hsa-miR-1468 InhibitorCUCCGUUUGCCUGUUUCGCUG5 nmol¥38,000
MIM0829hsa-miR-1469 MimicCUCGGCGCGGGGCGCGGGCUCC5 nmol¥38,000
INH0829hsa-miR-1469 InhibitorCUCGGCGCGGGGCGCGGGCUCC5 nmol¥38,000
MIM0830hsa-miR-1470 MimicGCCCUCCGCCCGUGCACCCCG5 nmol¥38,000
INH0830hsa-miR-1470 InhibitorGCCCUCCGCCCGUGCACCCCG5 nmol¥38,000
MIM0831hsa-miR-1471 MimicGCCCGCGUGUGGAGCCAGGUGU5 nmol¥38,000
INH0831hsa-miR-1471 InhibitorGCCCGCGUGUGGAGCCAGGUGU5 nmol¥38,000
MIM0832hsa-miR-1537 MimicAAAACCGUCUAGUUACAGUUGU5 nmol¥38,000
INH0832hsa-miR-1537 InhibitorAAAACCGUCUAGUUACAGUUGU5 nmol¥38,000
MIM0833hsa-miR-1538 MimicCGGCCCGGGCUGCUGCUGUUCCU5 nmol¥38,000
INH0833hsa-miR-1538 InhibitorCGGCCCGGGCUGCUGCUGUUCCU5 nmol¥38,000
MIM0834hsa-miR-1539 MimicUCCUGCGCGUCCCAGAUGCCC5 nmol¥38,000
INH0834hsa-miR-1539 InhibitorUCCUGCGCGUCCCAGAUGCCC5 nmol¥38,000
MIM0835hsa-miR-1825 MimicUCCAGUGCCCUCCUCUCC5 nmol¥38,000
INH0835hsa-miR-1825 InhibitorUCCAGUGCCCUCCUCUCC5 nmol¥38,000
MIM0837hsa-miR-1827 MimicUGAGGCAGUAGAUUGAAU5 nmol¥38,000
INH0837hsa-miR-1827 InhibitorUGAGGCAGUAGAUUGAAU5 nmol¥38,000
MIM0838hsa-miR-1908 MimicCGGCGGGGACGGCGAUUGGUC5 nmol¥38,000
INH0838hsa-miR-1908 InhibitorCGGCGGGGACGGCGAUUGGUC5 nmol¥38,000
MIM0839hsa-miR-1909-3p MimicCGCAGGGGCCGGGUGCUCACCG5 nmol¥38,000
INH0839hsa-miR-1909-3p InhibitorCGCAGGGGCCGGGUGCUCACCG5 nmol¥38,000
MIM0840hsa-miR-1909-5p MimicUGAGUGCCGGUGCCUGCCCUG5 nmol¥38,000
INH0840hsa-miR-1909-5p InhibitorUGAGUGCCGGUGCCUGCCCUG5 nmol¥38,000
MIM0841hsa-miR-1910 MimicCCAGUCCUGUGCCUGCCGCCU5 nmol¥38,000
INH0841hsa-miR-1910 InhibitorCCAGUCCUGUGCCUGCCGCCU5 nmol¥38,000
MIM0842hsa-miR-1911-3p MimicCACCAGGCAUUGUGGUCUCC5 nmol¥38,000
INH0842hsa-miR-1911-3p InhibitorCACCAGGCAUUGUGGUCUCC5 nmol¥38,000
MIM0843hsa-miR-1911-5p MimicUGAGUACCGCCAUGUCUGUUGGG5 nmol¥38,000
INH0843hsa-miR-1911-5p InhibitorUGAGUACCGCCAUGUCUGUUGGG5 nmol¥38,000
MIM0844hsa-miR-1912 MimicUACCCAGAGCAUGCAGUGUGAA5 nmol¥38,000
INH0844hsa-miR-1912 InhibitorUACCCAGAGCAUGCAGUGUGAA5 nmol¥38,000
MIM0845hsa-miR-1913 MimicUCUGCCCCCUCCGCUGCUGCCA5 nmol¥38,000
INH0845hsa-miR-1913 InhibitorUCUGCCCCCUCCGCUGCUGCCA5 nmol¥38,000
MIM0847hsa-miR-1914-3p MimicGGAGGGGUCCCGCACUGGGAGG5 nmol¥38,000
INH0847hsa-miR-1914-3p InhibitorGGAGGGGUCCCGCACUGGGAGG5 nmol¥38,000
MIM0846hsa-miR-1914-5p MimicCCCUGUGCCCGGCCCACUUCUG5 nmol¥38,000
INH0846hsa-miR-1914-5p InhibitorCCCUGUGCCCGGCCCACUUCUG5 nmol¥38,000
MIM0849hsa-miR-1915-3p MimicCCCCAGGGCGACGCGGCGGG5 nmol¥38,000
INH0849hsa-miR-1915-3p InhibitorCCCCAGGGCGACGCGGCGGG5 nmol¥38,000
MIM0848hsa-miR-1915-5p MimicACCUUGCCUUGCUGCCCGGGCC5 nmol¥38,000
INH0848hsa-miR-1915-5p InhibitorACCUUGCCUUGCUGCCCGGGCC5 nmol¥38,000
MIM0850hsa-miR-1972 MimicUCAGGCCAGGCACAGUGGCUCA5 nmol¥38,000
INH0850hsa-miR-1972 InhibitorUCAGGCCAGGCACAGUGGCUCA5 nmol¥38,000
MIM0851hsa-miR-1973 MimicACCGUGCAAAGGUAGCAUA5 nmol¥38,000
INH0851hsa-miR-1973 InhibitorACCGUGCAAAGGUAGCAUA5 nmol¥38,000
MIM0854hsa-miR-1976 MimicCCUCCUGCCCUCCUUGCUGU5 nmol¥38,000
INH0854hsa-miR-1976 InhibitorCCUCCUGCCCUCCUUGCUGU5 nmol¥38,000
MIM0858hsa-miR-2052 MimicUGUUUUGAUAACAGUAAUGU5 nmol¥38,000
INH0858hsa-miR-2052 InhibitorUGUUUUGAUAACAGUAAUGU5 nmol¥38,000
MIM0859hsa-miR-2053 MimicGUGUUAAUUAAACCUCUAUUUAC5 nmol¥38,000
INH0859hsa-miR-2053 InhibitorGUGUUAAUUAAACCUCUAUUUAC5 nmol¥38,000
MIM0860hsa-miR-2054 MimicCUGUAAUAUAAAUUUAAUUUAUU5 nmol¥38,000
INH0860hsa-miR-2054 InhibitorCUGUAAUAUAAAUUUAAUUUAUU5 nmol¥38,000
MIM0861hsa-miR-2110 MimicUUGGGGAAACGGCCGCUGAGUG5 nmol¥38,000
INH0861hsa-miR-2110 InhibitorUUGGGGAAACGGCCGCUGAGUG5 nmol¥38,000
MIM0862hsa-miR-2113 MimicAUUUGUGCUUGGCUCUGUCAC5 nmol¥38,000
INH0862hsa-miR-2113 InhibitorAUUUGUGCUUGGCUCUGUCAC5 nmol¥38,000