Recombinant PRDM1 protein

Aliases: BLIMP1, PR/SET Domain 1, PR Domain Zinc Finger Protein 1
商品コード: 81277 Format: 20 µg ¥92,000 Buy
商品コード: 81977 Format: 1 mg ¥788,500 Buy

Request a quote for a bulk order Request Quote


Expressed In: Baculovirus Protein Species: Human

Contents

A representative Technical Data Sheet (TDS) is provided here. Please refer to the lot-specific TDS you will receive with your order for the lot-specific buffer contents and protein concentration.

Background

PRDM1 (PR/SET Domain 1), also called as Beta-Interferon Gene Positive-Regulatory Domain I Binding Factor, or BLIMP1, is a transcription factor that acts as a repressor of beta-interferon gene expression. It mediates a transcriptional program in various innate and adaptive immune tissue-resident lymphocyte T cell types such as tissue resident memory T (Trm), natural killer (trNK) and natural killer T (NKT) cells and negatively regulates gene expression of proteins that promote the egress of tissue-resident T-cell populations from non-lymphoid organs. PRDM1 plays a role in the development, retention and long-term establishment of adaptive and innate tissue-resident lymphocyte T cell types in non-lymphoid organs, such as the skin and gut, but also in other nonbarrier tissues like liver and kidney, and therefore may provide immediate immunological protection against reactivating infections or viral reinfection (By similarity).

Application Notes

This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for recombinant proteins. Additional characterization such as enzyme kinetic activity assays, inhibitor screening or other biological activity assays may not have been performed for every product.  All available data for this product is shown. 

Protein Details

Recombinant PRDM1 was expressed in a baculovirus expression system as the full length protein (accession number NP_001189.2) with an N-terminal FLAG tag. The molecular weight of PRDM1 is 93 kDa.

 

Recombinant PRDM1 protein gel
9% SDS-PAGE gel with Coomassie blue staining

MW: 93 kDa
Purity: >85%

HTRF Assay for Recombinant PRDM1 activity.
1 µM substrate dsDNA (5’ biotin GGCGCAGTGAAAGTGCGCGG 3’) was incubated with different concentrations of PRDM1 protein in reaction buffer containing 50 mM HEPES-NaOH pH 7.0, 100 µM ZnCl2, 0.1% BSA at room temperature for 1 hour. Anti FLAG antibody was used to detect reaction products.

Storage

Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation. Avoid repeated freeze/thaw cycles and keep on ice when not in storage.

Guarantee

This product is for research use only and is not for use in diagnostic procedures. This product is guaranteed for 6 months from date of arrival.